Genetics in the News Chromosomal Mutations Chromosome mutations

Genetics… …in the News

Chromosomal Mutations • Chromosome mutations are variations from the wild-type condition in. . . – chromosome number, – chromosome structure,

Karyotypes (viewing chromosomes) …the chromosome complement of a cell or individual, . . refers to the arrangement of metaphase chromosomes according to length,

Human Karyotypes Female Male

p Physical Maps (Cytological Maps) • AT versus GC rich regions stain differently, – i. e. Giesma stain, 1 – in a very reproducible fashion. • Short arm “petit” (p), long arm (q), • #s refer to regions, with differential staining. 2 3 q

Chromosomal Mutations – chromosome number, – structure,

Aneuploidy. . . the gain or loss of a single chromosome, – monosomy: the loss of a single chromosome, – trisomy: the gain of a single chromosome.

Meiotic Nondisjunction. . . variation in chromosome number is caused by the failure of paired homologs to segregate properly during meiosis.

2 n = 46, if human Normal Disjunction We are following one pair of homologs. first division second division haploid gamete (gametes) Disomic

2 n = 46, if human We are following one pair of homologs. Nondisjunction First Division first division second division haploid gamete (gametes) Trisomic Monosomic

2 n = 46, if human Nondisjunction We are following one pair of homologs. Second Division first division second division haploid gamete (gametes) Disomic Trisomic Monosomic

Monosomy, 2 n - 1 2 n = 45, 46 -5 The loss of a single chromosome in an otherwise diploid cell.

Autosomal Monosomy • nearly always deleterious, usually lethal, – recessive lethal alleles are expressed, C a B C A B c D d E E diploid monosomic C c c Aa BB Cc Dd CC Cc EE Cc cc recessive lethal alleles

Trisomy, 2 n + 1 2 n = 46 47, +3 The gain of a single chromosome in an otherwise diploid cell.

Autosomal Trisomy • generally deleterious, – usually changes the phenotype of the individual, A B C a B c D d d E E E trisomic

Jimsonweed (Datura stramonium) Trisomy in plants

Tomato

Down Syndrome (2 n = 47, +21) Trisomy in Humans

Down Syndrome (2 n = 47, +21) • occurs at a frequency of about 0. 15%, • mental retardation (I. Q. 20 - 50), • mean life expectancy is about 17 years, • 47, +21 females are fertile, • trisomy 21 risk factors, maternal age.

Down Syndrome Trisomy in Humans

Down Syndrome Critical Genes • Chromosome 21 has about + 351 genes, – natural feedback mechanisms limit dosage effects of most of these genes, • It is estimated that the improper expression of approximately 20 -40 genes produces the variety of phenotypes.

Maternal Age and Down Syndrome

Maternal Age? • in female humans*, oocytes arrest in Prophase I before birth, – meiosis continues upon menstruation, – thus, tetrad formation and cellular function must be maintained for decades. • and, as mother’s age increases, maternal detection of trisomy may be attenuated and spontaneous abortions drops. * Research may suggest otherwise.

Other Human Autosomal Trisomics • Edwards Syndrome (2 n = 47, +18) – – 0. 0125% live births, mental abnormalities, “faunlike ears”, “rockerbottom feet”, small jaw, nearly all die within several weeks of birth, • Patau Syndrome (2 n = 47, +13), – – 0. 005% live births, mental abnormalities, cleft lip, small mal-formed head, “rockerbottom feet”, mean life expectancy is about 130 days.

Autosomal Trisomy Causation • Age of Parents, • Random Errors, – or genetic predisposition, • Especially malfunction of recombination machinery, – crossing over and subsequent recombination are necessary for proper chromosome disjunction.

Sex Chromosome Monosomy • Turner Syndrome (2 n = 45, X), – sometimes referred to as XO,

Turner Syndrome (2 n = 45, X) - 0. 03% live female births, - infertile, - normal intelligence, although specific cognitive functions may be affected.

Sex Chromosome Trisomy • Klinefelter Syndrome (2 n = 47, XXY),

Klinefelter Syndrome (2 n = 47, XXY) - 0. 1% - 0. 2% live male births, - infertile, - mildly retarded. 48, XXXY; 48, XXYY; 49, XXXXY; 49, XXXYY

XXX Syndrome (2 n = 47, XXX) • 47, XXX Syndrome, – 0. 08 % female births, – typically normal development, – fertile.

XYY Syndrome (2 n = 47, XYY) • 2 n = 47, XYY Syndrome, – 0. 10 % male births, – above average height, – sub-normal intelligence, – fertile. Genetic Disposition for Antisocial and Criminal Behavior? No.

1, 000 Conceptions 850, 000 Live Births 150, 000 Spontaneous Abortions 5165 Chromosomal Abnormalities 1849 (about 2: 1 males) Sex Chromosome Aneuploid 1183 (20: 2: 1) Autosomal Trisomics

1, 000 Conceptions 850, 000 Live Births 150, 000 Spontaneous Abortions 75, 000 Chromosome Mutations 39, 000; Trisomics 13, 500; XO

Aneuploidy Summary • Autosomal Monosomy, – nearly always deleterious, • Autosomal Trisomy, – usually deleterious, – trisomic individuals usually show distinct phenotypes, • Sex Chromosome Aneuploidy, – results in Turner or Klinefelter Syndromes, – 2 n = 47, XXX, often normal, – 2 n = 47, XYY, mild retardation, tall.

Chapter 5 • Do all of the practice questions (except 20).

Plant Biotechnology Information later in the Quarter

Chromosomal Mutations • Chromosome mutations are variations from the wild-type condition in. . . – chromosome number, – chromosome structure,

Polyploidy …more than two haploid sets of chromosomes are present, – 2 n = diploid, – 3 n = triploid, – 4 n = tetraploid, – etc.

Polyploidy Generalities de novo • rare in most animal species, • known in lizards, fish and amphibians, • fairly common in plants, • odd numbers of ploidy are not usually maintained, – 3 n, 5 n, etc. • rarely found in organisms that rely on sexual propagation.

Autopolyploidy. . . polyploidy resulting from the replication of one or more sets of chromosomes, …the additional set of chromosomes is identical to the normal haploid complement of that species.

added 1 x 2 x

Autopolyploidy …can be induced by treating cells with the drug colchicine, â colchicine: is a alkaloid derivative from the autumn crocus (Crocus veneris), . . . inhibits microtubule polymerization, and thus inhibits the separation of chromosomes during meiosis. Crocus veneris …autumn crocus, …meadow saffron, …naked ladies.

Colchicine Treatment • 2 n cells undergo S-phase, • no separation of chromosomes is accomplished, • no cell division occurs, • at telophase, the nuclear membrane reforms, • treatment for one cell cycle leads to 4 n cells.

Natural Autopolyploidy • Heat, cold also affect microtubule polymerization and can lead to autopolyploidy.

Allopolyploidy …formed by the union of two or more distinct chromosome sets, . . . i. e. , from different species.

The Sad Tail of Raphanobrassica …Vegetable of the Proletariet? Cast Dr. G. Karpechenko, Russian Plant breeder, Brassica oleracea (2 n = 18), - cabbage, large above ground food stock, ~value-less root, Raphanus sativus (2 n = 18), - the common radish, large root food stock, ~value-less leaves.

Super Vegetable? Cabbage 2 n 1 = 18 n 1 = 9 Radish 2 n 2 = 18 n 2 = 9 x n 1 + n 2 = 18 sterile spontaneous autopolyploidy 2 n 1 + 2 n 2 = 36

Amphidiploid …double diploid, 2 n 1 + 2 n 2 …have balanced gametes of the type n 1 + n 2, these gametes fuse to make fertile 2 n 1 + 2 n 2.

Raphanobrassica? • Roots of cabbage, leaves of radish, – dud-vegetable for Karpechenko, abandoned the project. • Revived by the Scottish Plant Breeding Station in Dundee, Scotland, – Raphanobrassica’s high dry matter content makes it an excellent fodder for sheep and cattle.

Allopolyploidy in Plants Wheat Cotton Apples Plums Strawberries Longanberries Tobacco Potatoes more. . .

Plant secondary metabolite, inhibits microtubule function Autopolyploidy Applications • Treating a parent plant with colchicine often produces autopolyploidy, resulting in offsprings with larger flowers and/or fruit, 4 n 2 n 8 n 2 n

Allopolyploidy Applications B. oleracea (cabbage, cauliflower, Brocolli, kale, etc. ) 2 n = 18 n=9 B. n 1 napas + n 2 =( 19 Oil rape, canola oil) 2 n 1 + 2 n 2 = 38 n = 10 B. campestris (turnip, turnip rape) 2 n = 20 amphidiploid

4 n x 2 n = 3 n? • The creation of triploids can be accomplished by crossing a tetraploid with a diploid, • Most triploid individuals are sterile.

Generation of a Triploid Cells

Meiosis in a Triploid Organism

Who’d want to Eat That? • Bananas, • Seedless Watermelon, • Most other seedless varieties, • Some oysters.

Environmental Applications? grass carp (Ctenopharyngodon idella) • grass carp prefer pondweeds, • do not prefer plants such as cattail, water lily, etc. Ø Triploid grass carp do not reproduce…

Polyploidy Summary • More than 2 whole sets of chromosomes, • Autopolyploidy, – from the same genome, – naturally occurring, or induced, – often results in larger varieties, • Allopolyploidy, – from different genomes, – naturally occurring, or induced, – often results in larger varieties, • Autotriploids, – most often sterile – can produce beneficial traits.

Monoploidy …a haploid of a diploid is monoploid, …has one chromosome set.

Monoploid • male wasps, bees and ants have only 1 haploid genome, – males develop from unfertilized eggs, • gametes are formed by mitosis. Bees (example)

Monoploid Applications • monoploid plants can be created by culturing pollen grains (n = 1), – the population of haploid organisms is then screened for favorable traits, – the plants are then treated with colchicine which generates a 2 n plant homozygous for the favorable trait(s).

Chromosomal Mutations – chromosome number, – structure,

Chromosome Structure • Changes in chromosome structure can come about due to, deletions duplications rearrangements

Chromosomal Deletions …a deletion results in a lost portion of a chromosome, – deletion causative agents, • heat, • radiation, • viruses, • chemicals, • errors in recombination.

Terminal Deletions Off the End

Intercalary Deletions From the Middle

Recognizing Deletions Terminal Intercalary

Homologous Pairs? Intercalary Hemizygous Terminal Hemizygous: gene is present in a single dose. Psuedodominance: hemizygous genes are expressed.

Deletions …result in partial monosomy, Ø remember monosomy: 2 n, -1, …the organism is monosomic for the portion of the chromosome that is deleted, …as in monosomy, most segmental deletions are deleterious.

Cri-du-chat Syndrome (2 n = 46, -5 p)

2 n = 46, -5 p. . . terminal deletion of the small arm (petite arm) of chromosome 5, • Cri-du-chat Syndrome, – – 0. 002% live births, anatomic mutations, often mental retardation, abnormal formation of vocal mechanisms.

Chromosome Structure • Changes in chromosome structure can come about due to, deletions duplications rearrangements

Chromosomal Duplication. . . an event that results in the increase in the number of copies of a particular chromosomal region,

Duplication Cause and Effect Causes: – duplications often result from unequal crossing over, – can occur via errors in replication during S-Phase. Effects: – results in gene redundancy, – produces phenotypic variation, – may provide an important source for genetic variability during evolution.

Unequal Crossing Over Produces both duplications and deletions!

Duplication in Evolution …essential genes do not tolerate mutation, …duplications of essential genes, followed by mutations, confers adaptive potential to the organism, …new gene family members are ‘recruited’ to perform new functions.

flowering plant algae moss nutrients need uptake transport to other tissue transport to seeds

Arabidopsis

Chromosome Structure • Changes in chromosome structure can come about due to, deletions duplications rearrangements

Chromosomal Inversions …inversion: aberration in which a portion of the chromosome is turned around 180 o.

Paracentric Inversion. . . an inversion in which the centomere is not included, A B C A B B A C . . . a paracentric inversion does not change arm length ratio.

Inversion Heterozygotes …an organism with one wild-type and one chromosome containing an inversion, A B C B A C …not heterozygous for the genes, heterozygous for the chromosomes.

Inversion Loop no crossing over gametes

Paracentric Produces haploid gamete.

Paracentric Produces gamete with inversion.

Paracentric Produces a chromosome with two centromeres. Nonviable gametes.

Dicentric. . . a chromosome having two centromeres;

Non-Viable (gametes) Segregate

Dicentric/Ascentric …results only when the crossing over occurs within the region of the paracentric inversion,

Paracentric No centromeres. Deletions. Nonviable gametes.

Acentric …a chromosome having no centromeres, …segregates to daughter cells randomly, or is lost during cell division, …deletions impartial monosomy.

Paracentric Outcomes 1 Normal Gamete, 1 Inversion Gamete, No Crossover Classes Recombination is not inhibited, but recombinant gametes are selected against.

Pericentric Inversion. . . an inversion in which the centromere is included, A B C A C B . . . a pericentric inversion results in a change in chromosome arm length.

Pericentric

Recombination and Inversions • Paracentric and Pericentric; – 1 Normal Gamete, – 1 Inverted Gamete, – (No) Crossover Classes = No Recombination… …in area of inversion. Inversions select against recombinant gametes, thus preserves co-segregation of specific alleles.

Inversions and Evolution • Inversions ‘lock’ specific alleles together, – all offspring get their alleles from either a wildtype, or inverted chromosome, • If the ‘set of alleles’ is advantageous, the set can be maintained in the population.

Assignment • Know how inversions alter the outcomes of recombination, • Understand the differences between ‘Interference’, and the suppression of recombination resulting from inversions, • Be able to recognize data, and predict results given either case.

Chapter 5 • Do all of the practice questions (except 20).

Chromosome Structure • Changes in chromosome structure can come about due to, deletions duplications rearrangements

Translocations …translocation: aberration associated with the transfer of a chromosomal segment to a new location in the genome.

Terminal Translocation

Reciprocal Translocation

Translocation and Semi-Sterility …semi-sterility; a condition in which a proportion of all gametophytes (in plants) or zygotes (in animals) are inviable. • Up to 50% are not viable as a result of translocations.

Robertsonian Translocations …the fusion of long arms of acrocentric chromosomes,

Down Syndrome • 95% of Down Syndrome individuals are a result of Trisomy 21, – the probability of having a second Down Syndrome child is usually similar to the population at large, • However, there is second cause of Down Syndrome caused by a Robertsonian translocations that is heritable.

Familial Down Syndrome

Assignment • Do a Punnett Square or a Split Fork Diagram of, Parent 1: wild-type for Chromosomes 14, 21 x Parent 2: heterozygous for 14 q; 21 q translocation.

Hint gametes

Trinucleotide Repeat Expansions FMR 1 Fragile X Mental Retardation 1. . . GCGCGGCGGTGACGGAGGCGCCGC TGCCAGGGGGCGTGCGGCAGCG. . . cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg …CTGGGCCTCGAAGCGCCCGCAGCCA cgg cgg. . . cgg cgg > 200

Fragile Site Mutations

Syntenic • Relationship of two or more loci found to be linked in one species; literally “on the same thread”. • Conserved Synteny: state in which the same two loci are found to be linked in several species.

Cereals

Conserved Synteny Description of DNA segments in which gene order is identical between species.

Chapter 5 Review • know genotypes and phenotypes for exam 2, – – – – trisomy, monosomy, inversions, duplications, deletions, polyploidy, dosage compensation. • be able to predict heritability, and recognize data-sets and infer the condition.

Wednesday • Work Chapter 5 problems, we’ll work them together. • Quiz through assigned reading (syllabus). • Keep studying.

Exam #1 Mean = 82. 5% Median = 81% Mode = 82. 5% A range: | | | B range: | | | C range: | | | D range: | | | Failing: |