Good Morning So far midterm average 72 If

Good Morning! • So far, midterm average = 72%!!!! • If you haven’t taken your midterm exam yet, then you have until this Thursday. – Bring your completed Midterm Study Guide – Come see me any morning! – If you haven’t tested by Thursday, then you will have an opportunity in class that day. No Warm-up Today. Have out your SPIRAL NOTEBOOK and your BINDER.

DNA vs. RNA Amoeba Sisters Video: “Why RNA is Just as Cool as DNA” Greenhouse! Write D, R, or Both in each box as you watch the video

PROTEIN SYNTHESIS 1. TRANSCRIPTION 2. TRANSLATION

Intro. to Protein Synthesis • Amoeba Sisters Video: “Protein Synthesis and the Lean, Mean Ribosome Machines”

Step 1 = TRANSCRIPTION DNA m. RNA Step 2 = TRANSLATION m. RNA DNA Not on your sheet!

Step 1: Transcription • • Process of creating m. RNA from a DNA template(pattern) [DNA m. RNA] Takes place in the nucleus TRANSCRIPTION PROCESS: 1. Enzymes unzip the DNA molecule 2. Free RNA nucleotides pair with matching DNA nucleotides • C pairs with G • G pairs with C T pairs with A A pairs with U 3. When base pairing is complete, the m. RNA molecule breaks away and DNA reforms. 4. The m. RNA leaves the nucleus and enters the cytoplasm

RNA • Function: Decodes information from DNA, then transports the message (code) to the Ribosome for protein assembly.

Differences in DNA and RNA • DNA • RNA 1. Double stranded 2. Deoxyribose sugar 3. Contains Thymine as a nitrogen base 1. Single stranded 2. Ribose sugar 3. Contains Uracil as a Nitrogen base in place of Thymine

Types of RNA • m. RNA – carries coded DNA message out of nucleus • t. RNA – transports amino acids to the ribosome • r. RNA - involved with the ribosome

Essential Questions WHITE BOARD! 1. 2. 3. 4. What is Transcription? Where does transcription occur? What is m. RNA? How is m. RNA different from DNA?

Essential Questions Write it down! 1. What is Transcription? Making m. RNA from DNA (DNA m. RNA) 2. Where does transcription occur? nucleus 3. What is m. RNA? A message (messenger RNA) 4. How is m. RNA different from DNA? m. RNA leaves the nucleus, single strand, ribose sugar, Uracil base DNA stays in nucleus, double strand, deoxyribose, Thymine base

Translation m. RNA • Assembling of amino acids to form proteins • The CODON sequence of m. RNA is translated into the amino acid sequence of a protein • Occurs in cytoplasm at ribosomes PROTEIN

Protein Synthesis SUMMARY • The building blocks of proteins are amino acids • DNA is the blueprint for the production of PROTEINS • 3 nitrogen BASES representing an amino acid is called a codon DNA RNA PROTEIN called: Central Dogma

Essential Questions WHITE BOARD! 1. 2. 3. 4. 5. What is translation? Where does it occur? What is a codon? What are the monomers of Proteins? How does DNA code for protein?

Essential Questions Write it down! 1. What is translation? Going from m. RNA to a protein (m. RNA protein) 2. Where does it occur? In cytoplasm at ribosomes 3. What is a codon? 3 m. RNA nucleotide bases that code for an amino acid 4. What are the monomers of Proteins? Amino acids 5. How does DNA code for protein? DNA sends code/instructions with m. RNA to ribosome to make the amino acid chain (protein)

DNA vs. RNA Amoeba Sisters Video: “Why RNA is Just as Cool as DNA” Greenhouse! Write D, R, or Both in each box as you watch the video

Protein Synthesis Coloring • Follow the directions to color the diagrams of TRANSCRIPTIONS and TRANSLATION • Answer the questions. Return all colored pencils to the box when you are finished!

Intro. to Protein Synthesis • Amoeba Sisters Video: “Protein Synthesis and the Lean, Mean Ribosome Machines”

Transcription and Translation Practice Greenhouse!

Put it all together! Transcription! Translation! Now finish 10 -16

White Board Warm-up! 1. Is the sequence below from a molecule of DNA or a molecule of RNA? How do you know? ATCGTAGGC 2. Write the complementary DNA sequence to the strand above.

White Board Warm-up! 3. What are the monomers of nucleic acids (DNA, RNA)? 4. List the 3 parts of a nucleotide. 5. How are DNA and RNA different?

PROTEIN SYNTHESIS DNA RNA Protein Step 1 Step 2

Transcription or Translation? How can you tell?

Transcription or Translation? How can you tell?

Transcription or Translation? How can you tell?

Transcription or Translation? How can you tell?

What is this process? ? ? How can you tell? DNA Replication

Protein Synthesis Practice Problems • Complete all the questions. • Use your notes if you need to! • Work independently.

Essential Tasks 1. Contrast Translation and Transcription – Translation is the creation of protein from m. RNA – Transcription is the creation of RNA from DNA 2. Track the production of proteins starting with a single strand of DNA. – DNA (transcription) m. RNA – (translation via t. RNA) Amino Acid – Bind to form proteins

Happy Thursday! • Complete the Warm-up! Protein Synthesis Quiz will be after the warm -up

Protein Synthesis Quiz • 15 minutes • You may look at your notes during the last 3 minutes of the quiz. I will tell you when. • All quizzes will be collected after 15 minutes.

Midterm Make-up Time Everyone Else: Test Takers: Ø Turn in your Study Guide to Ø Read and complete the “How do Genes Work” me. and answer questions 1 -8. Ø During the test: Ø Read the section on DNA Ø Mark in the test book Replication and Ø Use a #2 pencil on the bubble sheet Mutations then answer Ø Absolutely NO cell phones the questions OR headphones Ø Complete BOTH sides of Ø No talking the worksheet

HOMEWORK • Complete the DNA Replication and Protein Synthesis Study Guide Sheet. • You will need a blue m. RNA codon chart!

Welcome Back! • Complete the yellow warm-up sheet USING YOUR NOTES on protein synthesis! • Your Protein Synthesis Study Guide (homework) will be DUE on Wednesday. • Unit 6 Test is this Thursday – DNA vs RNA – DNA Replication – Protein Synthesis – Mutations

Protein Synthesis Quiz (from last Thursday) • 1. Given the following DNA strand the m. RNA codon chart, what would the correct amino acid sequence be? (First, do transcription, then translation) DNA: T A C A T G C T C A T C

2. What process does this diagram represent? (2 pts) Explain how you can tell: _____________________________________ ______ 3. Which of these is most responsible for carrying coded information out of the nucleus into the cytoplasm? a. ATP b. m. RNA c. DNA d. t. RNA

4. What process is shown in the diagram to the right? 5. Genetic information usually flows in one specific direction. Which of the following best represents this flow? a. DNA → Protein → RNA b. Protein → RNA → DNA c. RNA → Protein → DNA d. DNA → RNA → Protein 6. Which statement about m. RNA is correct? a. It carries messages from the ribosomes to the mitochondria. b. It carries messages from the mitochondria to the nucleus. c. It carries messages from the chromosomes to the ribosomes. d. It carries messages from the chromosomes to the mitochondria.

1. 2. 3. 4. 5. ______________________ ___________ Function (job/role) of #2: Function (job/role) of #3: Function (job/role) of #5: 7. What is the name of the process that is occurring in the diagram?

Genetic Mutations POGIL What mistakes can occur when DNA is replicated? Group 1 Group 2 Group 3 Group 4 Group 5 Alex ___________ Kaylon ___________ Sha-Monie ___________ Diondra ____________ Devante ____________ These are the group Leaders/Managers. Leaders, select 2 -3 other class mates to join your group!

Mutations Amoeba Sisters: “Mutations: The Potential Power of a Small Change” After watching first half: Fill in the worksheet! Greenhouse!

Mutations Worksheet Original DNA Sequence: TACACCTTGGCGACGACT Transcription! m. RNA __________ Translation! Amino Acid Sequence: Use the Codon Chart! __________

m. RNA Amino Acid Sequence: AUG UGG AAC CGC UGA ______________

Mutations Worksheet – Try one More Mutated DNA Sequence #1: TACATCTTGGCGACGACT Transcription! m. RNA __________ Translation! Amino Acid Sequence: Use the Codon Chart! __________

m. RNA AUG UAG AAC CGC UGA Will there likely be effects? What kind of mutation? Amino Acid Sequence: ______________

Mutations Worksheet Mutated DNA Sequence #2: Transcription! m. RNA TACGACATCTTGGCGACGACT __________ Translation! Amino Acid Sequence: Use the Codon Chart! Will there likely be effects? __________ What kind of mutation is this?

Protein Synthesis Activity! How does DNA Code for Traits in Plants? Greenhouse!

PROTEIN SYNTHESIS • To start, read the “How do Genes Work” and answer questions 1 -8. Greenhouse!