DNA Transcription and Translation Sections 12 3 and
- Slides: 132
DNA Transcription and Translation Sections 12. 3 and 12. 4
Do Now n 1. How many chromosomes do we have? n 2. What is a chromosome made of? n 3. What is a gene?
Objectives n n n SWBAT label parts of a RNA molecule SWBAT compare and contrast DNA and RNA SWBAT define gene, polypeptide, and amino acid.
Gene n n Segment of DNA that codes for a protein DNA codes for RNA and RNA makes protein
One Gene – One Enzyme n n The Beadle and Tatum experiment showed that one gene codes for one enzyme. One gene codes for one polypeptide - a chain of covalently bonded amino acids. (proteins are made of one or more polypeptide)
12. 3 DNA, RNA, and Protein
Let’s make some observations about RNA’s structure
RNA n RNA stands for: n n Ribonucleic acid RNA is found: n Nucleus and Cytoplasm
RNA Structure n Like DNA, RNA is made up of subunits called _______, which are made of three parts: n n n Sugar (ribose) Phosphate Nitrogen Base
RNA’s Nitrogen Bases n n Adenine (A) Cytosine (C) Guanine (G) Uracil (U)
There are 3 types of RNA: n n n Messenger RNA (m. RNA) Ribosomal RNA (r. RNA) Transfer RNA (t. RNA)
All RNA is … n n n Single stranded Many different shapes “Cheap copy” of DNA
Do Now n n 1. What is a protein made of? 2. Explain the process between DNA and proteins.
Objectives n n SWBAT draw and create a segment of RNA SWBAT answer questions on your segment.
Do Now n Compare and Contrast DNA and RNA.
Objectives n n n SWBAT define RNA polymerase, transcription, promotor, termination sequence. SWBAT identify the steps involved in transcription SWBAT answer question on transcription.
Transcription n n First step in making proteins Process of taking one gene (DNA) and converting into a m. RNA strand DNA -> RNA Location: n Nucleus of the cell
Steps to Transcription n 1. An enzyme attaches to the promoter (start signal region) of a gene and unwinds the DNA
Steps to Transcription (Cont. ) n 2. One strand acts as a template.
Steps to Transcription (Cont. ) n n n 3. A m. RNA copy is made from the DNA template strand by RNA polymerase 4. A m. RNA copy is made until it reaches the termination (stop signal) sequence 5. The two strands of DNA rejoin.
Template vs. Non Template Strand
Transcription animations n n http: //wwwclass. unl. edu/biochem/gp 2/m_biology/a nimation/gene_a 2. html http: //www. fed. cuhk. edu. hk/~johnson/t eaching/genetics/animations/transcripti on. htm
Transcribe this DNA to m. RNA
Think- Pair- Share n n n 1. Where in the cell does transcription occur? 2. What nucleic acids are involved in the process of transcription? 3. What is the importance of transcription? 4. In transcription, how come the whole DNA molecule is not copied into m. RNA? 5. How does one gene differ structurally from another? 6. Because one gene differs from another, what molecules in the cell will also be different?
Do Now n Label the Transcription diagram
Objectives n n SWBAT label a diagram of transcription SWBAT answer questions on transcription.
Do Now n List the steps to transcription.
Do Now n n n 1. What is transcription? 2. Transcribe this DNA sequence: TCAGTTGAGGAACCT
Objectives n n 1. SWBAT discuss translation using pictures, words, models, and online animations. 2. SWBAT draw out translation in their notes. 3. SWBAT complete a conclusion activity using a worksheet. 4. SWBAT answer multiple choice and short answer questions about transcription and replication.
m. RNA Processing n n Pre-m. RNA – the original sequence of RNA created during transcription m. RNA reaches the ribosomes
RNA Processing
n After transcription the pre-m. RNA molecule undergoes processing n n n 5’ cap is added Poly A tail is added to the 3’ end Introns are removed.
RNA Processing n n n In Eukaryotes only Introns- non-coded sections Exons- codes for a protein Before RNA leaves the nucleus, introns are removed and exons are spliced together A cap and poly A tail are added to ends of the sequence m. RNA leaves the nucleus through the nuclear pores
Why is it necessary to add the poly A tail and 5’ cap?
Let’s try an activity (11. 5) n http: //highered. mcgrawhill. com/olcweb/cgi/pluginpop. cgi? it=sw f: : 535: : /sites/dl/free/0072437316/ 120077/bio 30. swf: : How%20 Spliceosom es%20 Process%20 RNA
Pg. 339 n Pg. 339
Let’s an example… n Original DNA Sequence (DNA): 5’ GTACTACATGCTATGCAT 3’ Translate it (RNA): 3’ CAUGAUGUACGAUACGUA 5’ n Add the 5’ cap: n n n 3’ CAUGAUGUACGAUACGUA cap 5’
Finish the job! n Remove the introns “UGUA” and “AUAC”: 3’ CAUGAUGUACGAUACGUA cap 3’ CAUGACGGUA cap 5’ Add a poly A tail onto the 3’ end 3’AAAAACAUGACGGUA cap 5’ 5’
Get a new partner! n n DNA Strand of non-template strand: 5’ ATCGGTAGAGTATTTACAGATA 3’ Remove introns: CGGUA UUACAG
Think, Pair, Share n n n Take a minute think on your own, then pair with your partner, and share your ideas! Evolutionary, why do you think there are introns? Where did they come from? Why do we have them? Remember there is NO wrong answer!
PROTEINS!
Proteins are made up of amino acids!!! n n n Proteins are polymers of amino acids Only 20 different amino acids BUT there are hundreds of thousands of different proteins How can this be?
Let’s compare to it to the English language How many letters are in the alphabet? A, b, c, d, … 26 n How many words are there? Miss, Ings, is, smart, . . Almost infinite! n Each word has a unique structure of letters. n n Similar to proteins and amino acids
Do Now n n Perform transcription on this DNA segment: 3 GCTTCATACGA 5’ Do RNA processing and remove the introns: GAA and UGC How does this m. RNA sequence leave the nucleus? Where does it go?
Objectives n n 1. SWBAT draw and describe the process of translation. 2. SWBAT watch animations and answer questions about DNA transcription and translation.
Proteins- (PCFNa) -made of 20 different Amino Acids - Amino Acids bond to form polypeptide chains
How do amino acids form these peptide chains? Peptide Bonds – Link each amino acids together to form proteins
How many amino acids are in a dipeptide chain? How about a tripeptide chain? How many water molecules are formed from 2 amino acids? How many water molecules are formed from 100 amino acids?
Protein Structure http: //www 3. interscience. wiley. com: 8100/legacy/college/boyer/0471661791/structure/Hb. Mb/hbmb. htm
Translation n n Production of proteins from m. RNA goes to the ribosomes in the cytoplasm or the RER and produces proteins
Steps to Translation n n 1. m. RNA leaves the nucleus and binds to a ribosome 2. the 5’ end of m. RNA binds to ribosome
Ribosome n n n Two subunits to the ribosome 3 grooves on the ribosome (A, P, E) A: t. RNA binding site P: polypeptite bonding site E: exit site
Steps to Translation (Cont. ) n 3. Ribosome looks for the start Codon (AUG) n Codon: group of 3 nucleotides on the messenger RNA that specifies one amino acid (64 different codons)
Steps to Translation (Cont. ) n n 4. Amino acids attached to a t. RNA molecule and are brought over to the m. RNA. 5. This t. RNA has an anticodon that matches the codon on the m. RNA strand Anticodon: Group of 3 unpaired nucleotides on a t. RNA strand. (binds to m. RNA codon)
Translation Animations n n http: //wwwclass. unl. edu/biochem/gp 2/m_biology/a nimation/gene_a 3. html http: //www. stolaf. edu/people/giannini/fl ashanimat/molgenetics/translation. swf
t. RNA
Think-Pair-Share n The m. RNA sequence reads the following codons: What amino acids do they stand for? n n AUG GGA GAG CAA ** What amino acid does the anticodon CGU stand for? ***
Period 3 Do Now
Steps to Translation (Cont. ) n n n 6. t. RNA binds to the m. RNA sequence and adds an amino acid 7. Each amino acid matches up with 1 -6 t. RNA molecules 8. t. RNA leaves and amino acids bond together through a polypeptide bond
Steps to Translation (Cont. ) n n 9. The m. RNA sequence continues until a stop codon is reached. 10. The amino acids disconnect from the m. RNA sequence and a protein is formed.
Think – Pair - Share n n Find the amino acid sequence for the following m. RNA sequence (translation) AUGCGACGAAUUUAA
Translation Animations n n http: //wwwclass. unl. edu/biochem/gp 2/m_biology/a nimation/gene_a 3. html http: //www. stolaf. edu/people/giannini/fl ashanimat/molgenetics/translation. swf
Do Now Do transcription on this DNA sequence: CGTACGCTCCCTAGACTA n Do Translation- Remember to start the right place!
Objectives n n 1. SWBAT draw and describe the process of translation. 2. SWBAT answer questions about DNA transcription and translation.
Think-Pair-Share n Get with a partner, one partner transcribes and the other translates.
Do Now Do transcription on this DNA sequence: TTTTATACTGAGGGTTAACTCGT n Do Translation- Remember to start the right place!
1. 2. 3.
4. 5. 6.
1. Initiation n The two ribosomal subunits come together with the m. RNA and the first t. RNA molecule which attaches to the start codon (AUG). This is the only t. RNA that will attach to the P site. The first amino acid is always methionine.
2. Codon Recognition n The t. RNA anticodon will hydrogen bind to the m. RNA codon in the A site.
3. Bond Formation n The amino acid in the P site will form a peptide bond with the amino acid in the A site.
4. Translocation n The t. RNA's and the m. RNA move down one site. The empty t. RNA is released from the exit site.
5. Repeat n This process will repeat hundreds of times.
6. Termination n n Translation is terminated with the stop codon is reached. There are three different stop codons UGA, UAG. The release factor recognizes the stop codon and releases the polypeptide strand. All the factors break apart and are reused.
Do Now n n n Take the following amino acid sequence, do reverse transcription and translation (find RNA and DNA). Methionine, Arginine, Alanine, Serine, Tryptophan, Tyrosine, Leucine, Valine, stop What do you notice about your DNA sequences?
Do Now
Do Now Do transcription on this DNA sequence: TTTTATACTGAGGGTTAACTCGT n Do Translation- Remember to start the right place!
Do Now- period 3 n Template strand of DNA: 5’ TTACGGCTAGGAGTAGCCGAATTCTG 3’ n Remove the introns: CUCAUC n Determine protein sequence n
Objectives n n n 1. SWBAT identify the parts of translation. 2. SWBAT practice transcribing and translating a gene sequence. 2. SWBAT answer multiple choice and short answer questions about DNA replication, transcription, translation, and mutations.
Translation Animations n n http: //wwwclass. unl. edu/biochem/gp 2/m_biology/a nimation/gene_a 3. html http: //www. stolaf. edu/people/giannini/fl ashanimat/molgenetics/translation. swf
Worksheet n Practice transcribing and translating with a partner
Do Now n What do you think would happen if there was a mistake in transcription?
Objectives n n n 1. SWBAT discuss the different types of mutations and affects it causes on transcription. 2. SWBAT create different types of mutations and translate the sequence. 3. SWBAT brainstorm the evolutionary importance of mutations.
Liam Extraordinary People n http: //www. youtube. com/watch? v=CDll YLas. Hx. U
How do cells know what protein to make when? n Gene Regulation: ability of an organism to control which genes are transcribed.
Controlling Transcription n n Transcription factors ensure that a gene is used at the right time and that protein are made in the right amounts The complex structure of eukaryotic DNA also regulate transcription.
HOX Genes n n Everyone develops from a zygote Zygote undergoes mitosis Cell differentiation: cells become specialized Certain gene sequences determine cell differentiation
Do Now n What is gene regulation? n What are transcription factors?
Objectives n n 1. SWBAT practice transcribing and translating mutated sequences. 2. SWBAT identify and research on mutation that leads to a genetic abnormality.
HOX Genes § Homeobox Genes (Hox Genes) are sequences of DNA § Hox genes are responsible for the general body pattern of most animals.
HOX Genes n n Are transcribed at specific times, and located in specific places on the genome Mutations:
Telephone n n We are going to play the game telephone. Every time a DNA makes a copy (spreading of a message), mutations can happen (mistakes in a message)
Mistakes in DNA n n n Cell make mistakes in replication, and transcription Most often these mistakes are fixed EX.
Mutations n n A permanent change that occurs in a cell’s DNA is called a mutation. Three types of mutations: n n n Point mutation Insertion Deletion
Point Mutation n Substitution: A change in just one base pair n n Missense Mutation: amino acid is change Nonsense Mutation: amino acid is changed to a stop codon
Frameshift Mutations n n n Causes the reading frame to shift to the left or the right Insertion: Addition of a nucleotide Deletion: Removal of a nucleotide
Do Now – ACGAAATACAGACAT n Decide what type of mutation occurred: n ACGAAATAGAGACAT n ACAAATACAGACAT n ACGAAATACAGGACAT
Objectives n n 1. SWBAT identify causes of genetic mutations. 2. SWBAT identify and research on mutation that leads to a genetic abnormality.
Causes of Mutations n n Mutations can happen spontaneously Mutagens: Certain chemicals or radiation that can cause DNA damage Causes bases to mispair and bond with the wrong base High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic.
Sex Cell vs. Somatic Cell Mutations § Somatic cell mutations are not passed on to the next generation. n Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring
Chromosomal Mutations n Piece of chromosome can be broken off, duplicated, or moved to another chromosome
Fragile X Syndrome n n Repeat of CGG about 30 times Causes mental and behavior impairments
Protein Folding and Stability n n n Substitutions also can lead to genetic disorders. Ex. Sickle Cell Anemia (caused by a substitution mutation) Can change both the folding and stability of the protein
Sickle Cell Anemia
Causes of Mutations n n Mutations can happen spontaneously Mutagens: Certain chemicals or radiation that can cause DNA damage Causes bases to mispair and bond with the wrong base High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic.
Sex Cell vs. Somatic Cell Mutations § Somatic cell mutations are not passed on to the next generation. n Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring
- Dna coloring transcription and translation
- Dna transcription and translation
- Dna replication transcription and translation
- Dna and transcription tutorial
- Overview of transcription and translation
- Venn diagram dna and rna
- Protein synthesis bbc bitesize
- Translate
- Picture transcription
- Transcription and translation
- Biology transcription and translation
- Transcription and translation practice worksheet answer key
- Differences between dna and rna
- Transcription
- Ribosomem
- Dna transcription
- Rho independent termination
- Dna to rna transcription
- Dna code
- Dna transcription
- Dna transcription
- Transcription translation replication
- Blood type chart
- Dna meaning
- Translation transcription
- Transcription or translation
- Translation transcription
- Central dogma
- Coding dna and non coding dna
- Communicative translation meaning
- Linear function transformations
- Function of dna polymerase 3
- Bioflix activity dna replication lagging strand synthesis
- Enzyme involved in dna replication
- Dna and genes chapter 11
- Rna bases
- Translate
- Voice translation-rule
- Noun phrase example
- How to write 115 on a check
- Narrow and broad transcription
- Language
- Where did hiv come from
- Speech phonetic transcription
- Prokaryotic vs eukaryotic transcription
- Transcription sounds
- Odd phonetic transcription
- Transcription error
- Phonetic transcription
- Prokaryote vs eukaryote cells
- Arthur the rat phonetic transcription
- Tomb phonetic transcription
- Lego transcription
- Termination of transcription in prokaryotes
- Transcription in prokaryotes
- Transcription
- Cot phonetic transcription
- Basal transcription apparatus
- Reverse transcription
- Rna transcription
- Transcription city
- Transcription
- Transcription
- Rho factor
- Types of dna polymerase in eukaryotes
- Transcription
- Idea transcription
- Computer aided transcription software
- Transcription
- What is it called?
- Transcription
- Coarticulation in phonetics
- Akaptonuria
- Initiation complex
- Transcription
- Eukaryotic transcription
- Transcription
- Transcription process
- Activation domain of transcription factors
- Differential transcription
- Jml transcription
- Hüseyin mergan
- Crescendo transcription pvt ltd
- Cutaways and cross sections definition
- Adduction
- Anatomical position and regional terms
- Chapter 9 conic sections and analytic geometry
- 11.1 space figures and cross sections
- Health and safety at work act 1974 section 2
- Marie earns an 8 commission
- Basic principles of haircutting
- Volumes of solids with known cross sections calculator
- Directional terms planes and sections
- Body planes and sections
- Chapter 7 conic sections and parametric equations
- Chapter 9 conic sections and analytic geometry
- Volume of known cross sections
- Think on these things
- Declaration of independence sections
- Chapter 5 lesson 4 declaring independence
- Ctd sections
- Gastric arteries
- Sections in engineering drawing
- To show the surface of section hatching lines are drawn at
- Cutting view
- Pharynx parts
- Cobol sections
- Pga sections map
- Real life parabola
- Method of section
- Method of section
- Rotating conic sections
- Lesson 1 exploring conic sections
- Volumes using cross sections
- How conic sections are used in everyday life
- Erg green section
- Cross slice
- Cylinder sliced perpendicular to the base
- Parabola vs hyperbola
- Conic sections definition
- Conic sections
- Conics completing the square
- Ctd sections
- Conic sections calculator
- Conic sections equations
- Conic sections equations
- How to identify conic sections from general form
- Conic sections quiz
- There are six logical units or sections to a computer
- Classifying conic sections worksheet
- Equation for a hyperbola
- Conic sections in polar coordinates
- Product of inertia