Part 1 Working with RNASeq Data RNAseq overview















































































- Slides: 79
Part 1: Working with RNA-Seq Data
RNA-seq: overview Genome. …TCTGAAACAATGCTTCAATCTAACTTATCATTGGGA…. 2
RNA-seq: overview Genome Gene A Gene B Gene C 3
RNA-seq: overview Genome Gene A Transcr. A A Gene B Gene C Transcr. A C 4
RNA-seq: overview Genome Gene A Gene B Transcr. A A Gene C Transcr. A C Reads 5
RNA-seq: overview Genome Gene A Gene B Transcr. A A Gene C Transcr. A C Reads Transcr. A Transcr. C 6
RNA-seq: some details Genome Gene A Gene B Transcr. A Gene C Transcr. C C Shattering 7
RNA-seq: some details Genome Gene A Gene B Transcr. A Gene C Transcr. C Adapters ligation 8
RNA-seq: some details Genome Gene A Gene B Transcr. A Gene C Transcr. C PCR amplification 9
RNA-seq: some details Genome Gene A Gene B Transcr. A Gene C Transcr. C “Reading” 10
RNA-seq: per-sample processing Preprocessing: • Adapters removal plus additional trimming • Removing PCR duplicates Mapping • Mapping on the set of known transcripts • Mapping on genome (and potential identification of novel transcripts) • Combined strategy Quantification of expression levels 11
RNA-seq: Comments PCR removal should be used with caution to avoid removing natural duplicates (valuable links: http: //www. cureffi. org/2012/12/11/how-pcr-duplicates-arise-in-next-generation-sequencing/ https: //www. ncbi. nlm. nih. gov/pmc/articles/PMC 4965708/ - DNA-seq and variant calling https: //www. ncbi. nlm. nih. gov/pmc/articles/PMC 4597324/ - RNA-seq, Ch. IP-seq data https: //www. ncbi. nlm. nih. gov/pmc/articles/PMC 3871669/ - trimming 12
RNA-seq: processing 13
RNA-seq: processing 14
RNA-seq: expression level quantification Standard measures • read counts (raw, expected) • FPKM – fragments per kilo base per million mapped reads: Number of reads mapped on the gene / ((total number of mapped reads – in millions) x (gene length – in kilobases)) • TPM – transcripts per million For one sample TPMg = C x FPKMg, where C is selected in such a way that sum of all TPMg is one million. But constants C are different for different samples. 15
RNA-seq: expression level quantification Alternative definition of TPM: (Number of reads mapped on the gene x read mean length x 106) / (gene length x T), where T is the sum over all genes of (Number of reads mapped on the gene x read mean length) / gene length Each term here represents the number of sampled transcripts corresponding to a gene, and T estimates the total number of sampled transcripts (molecules). Thus, TPM is the estimate of the number of transcripts corresponding to a gene in every million transcripts. Details: Wagner G. P. , Kin K. , Lynch V. J. (Theory Biosci. , 2012) https: //www. ncbi. nlm. nih. gov/pubmed/22872506 16
RNA-seq: expression level quantification Linear scale vs Log-scale Relative differences are biologically more meaningful than absolute. Computations are simplified if a log-scaling is performed: Log-scaled measure = log 2 (linear-scale measure + shift) For relatively large values a difference equal to 1 in log-scale is a 2 x difference in linear scale; difference equal to 3 in log-scale is a 8 x difference in linear scale, etc. ; difference equal to -1 in log-scale is a 2 x difference in linear scale, but in the opposite direction. 17
Comparison: the role of preprocessing No preprocessing 18
Comparison: the role of preprocessing No PCR duplicate removal 19
Comparison: the role of preprocessing Standard 20
Comparison: the role of preprocessing (output) 21
Comparison: the role of preprocessing 22
Comparison: the role of preprocessing 23
Extended pipeline 24
Extended pipeline 25
BREAK 26
Part 2: Differential expression and pathway / gene set enrichment analysis
Differential expression analysis Quantities related to the degree of differential expression: • Difference between mean expression levels – fold change (please, pay attention to scale); • Statistical significance – p-value, adjusted p-value (e. g. , FDR) • Expression level magnitude (caution with lowexpressed genes from the analysis). 28
Differential expression analysis 29
Differential expression analysis 30
Gene set / pathway enrichment analysis Possible options: • Use only lists (thresholding required): one of the standard tools here is The Database for Annotation, Visualization and Integrated Discovery – DAVID (https: //david. ncifcrf. gov/home. jsp, https: //davidd. ncifcrf. gov/). • Take into consideration degrees of differential expression; • Additionally take into consideration pathway topology. 31
Gene set / pathway enrichment analysis 32
Gene set / pathway enrichment analysis 33
BREAK 34
Part 3: Unsupervised analysis
Unsupervised analysis: PCA 36
Unsupervised analysis: PCA 37
Unsupervised analysis: PCA 38
Unsupervised analysis: hierarchical clustering 39
Unsupervised analysis: hierarchical clustering 40
Unsupervised analysis: hierarchical clustering 41
Unsupervised analysis: hierarchical clustering 42
Unsupervised analysis: hierarchical clustering 43
Unsupervised analysis: hierarchical clustering 44
Unsupervised analysis: hierarchical clustering 45
Unsupervised analysis: hierarchical clustering 46
Unsupervised analysis: hierarchical clustering Dendrogram 47
Unsupervised analysis: hierarchical clustering Dendrogram 48
Unsupervised analysis: PCA (15 genes) 49
Unsupervised analysis: PCA (15 genes) 50
Unsupervised analysis: hierarchical clustering, 15 genes Dendrogram 51
Unsupervised analysis: hierarchical clustering, 15 genes Dendrogram Luminal C-low N-like Basal 52
Gene annotation: ENSG to Gene Symbols plus GO 53
Unsupervised analysis: K-means, 15 genes 54
Unsupervised analysis: K-means, 15 genes 55
Unsupervised analysis: K-means, 15 genes 56
Unsupervised analysis: K-means, 15 genes 57
Unsupervised analysis: K-means, 15 genes 58
Unsupervised analysis: K-means, 15 genes 59
Unsupervised analysis: K-means, 15 genes 60
Unsupervised analysis: K-means, 15 genes 61
Unsupervised analysis: K-means, 15 genes 62
Unsupervised analysis: K-means, 15 genes 63
Unsupervised analysis: K-means, 15 genes 64
Unsupervised analysis: K-means, 15 genes “The SUM 52 PE cell line was derived from a pleural effusion and was found to be negative for ER and PR expression, however the original primary tumor from this patient was positive for both hormone receptors”. Chavez KJ, Garimella SV, Lipkowitz S. Triple negative breast cancer cell lines: one tool in the search for better treatment of triple negative breast cancer. Breast Dis. 2010; 32(1 -2): 35 -48. Ethier SP, Kokeny KE, Ridings JW, Dilts CA. erb. B family receptor expression and growth regulation in a newly isolated human breast cancer cell line. Cancer Res. 1996; 56(4): 899 -907. 65
BREAK 66
Part 4: Supervised analysis: classification
Supervised analysis: SVM with a linear kernel as an example 68
Supervised analysis: SVM with a linear kernel as an example 69
Supervised analysis: SVM with a linear kernel as an example 70
Supervised analysis: SVM with a linear kernel as an example d d 71
Supervised analysis: SVM with a linear kernel as an example 72
Supervised analysis: SVM with a linear kernel as an example ? 73
Supervised analysis: SVM with a linear kernel as an example ? 74
Supervised analysis: available methods • Linear Discriminant Analysis (LDA) • Quadratic Discriminant Analysis (QDA) • Random Forest • Support Vector Machine (SVM) • Naïve Bayes 75
Supervised analysis: 15 genes 76
BREAK 77
BREAK HANDSON Separation of TCGA and breast cancer PDX samples 78
BREAK HANDSON Analysis of a subset of breast cancer PDX samples 79