DNA Protein Synthesis From Gene to Protein 1

DNA & Protein Synthesis From Gene to Protein 1

Nucleic Acids and Protein Synthesis • All functions of a cell are directed from some central form of information (DNA). • This "biological program" is called the Genetic Code. • This is the way cells store information regarding their structure and function. 2

History of DNA Composition and Structure 3

History • For years the source of heredity was unknown. This was resolved after numerous studies and experimental research by the following researchers: • Fredrick Griffith – He was studying effects of 2 strains of an infectious bacteria, the "smooth" strain was found to cause pneumonia & death in mice. The "rough" strain did not. He conducted the following experiment 4

Griffith Experiment Bacteria Strain injected into mouse Result Smooth Strain Mouse dies Rough strain Mouse Lives Heat-Killed Smooth strain Mouse lives Rough Strain & Heat killed smooth strain *MOUSE DIES* • The last condition was unusual, as he predicted that the mouse should live • Concluded that some unknown substance was Transforming the rough strain into the smooth one 5

Avery, Mc. Carty & Mac. Leod Tried to determine the nature of this transforming agent. Was it protein or DNA? • They Degraded chromosomes with enzymes that destroyed proteins or DNA • The Samples with Proteins destroyed would still cause transformation in bacteria indicating genetic material was DNA 6

Hershey-Chase • ONE virus was radioactively "tagged" with 32 P on it's DNA • The OTHER was "tagged" 35 S on it's protein coat. • Researchers found the radioactive P in the bacteria, indicating it is DNA, not protein being injected into bacteria. 7

Watson & Crick • The constituents of DNA had long been known. Structure of DNA, however was not. • In 1953, Watson & Crick published findings based on X-ray analysis (Rosalind Franklin) and other data that DNA was in the form of a "Double Helix". • Their findings show us the basic structure of DNA which is as follows. 8

DNA Structure The Double Helix 9

DNA Structure DNA is Formed of in a "Double Helix" 10 like a spiral staircase

Nucleotides • DNA is formed by Nucleotides • These are made from three components: 1. 5 -Carbon or pentose Sugar 2. Nitrogenous base 3. Phosphate group 11

Types of Nucleotides • For DNA There are 4 different Nucleotides categorized as either Purines (Double rings) or Pyrimidines (Single ring). These are usually represented by a letter. They Are: 1. 2. 3. 4. Adenine (A) Cytosine (C) Guanine (G) Thymine (T) Guanine 12

Base Pairing • Each "Rung" of the DNA "staircase" is formed by the linking of 2 Nucleotides through Hydrogen Bonds. • These Hydrogen bonds form only between specific Nucleotides. This is known as Base Pairing. The rules are as follows: – Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen bonds) – Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen bonds) 13

Central Dogma of Genetics DNA to Protein Synthesis 14

Central Dogma of Genetics • Central Dogma holds that genetic information is expressed in a specific order. This order is as follows There are some apparent exceptions to this. Retroviruses (eg. HIV) are able to synthesize DNA 15 from RNA

DNA Replication • DNA has unique ability to make copies of itself • The process is called DNA Replication. • First, the enzyme Helicase unwinds the parental DNA • DNA "Unzips itself" by breaking the weak hydrogen bonds between base pairs forming two TEMPLATE strands with exposed Nucleotides 16

DNA Replication • The place where helicase attaches and opens DNA is called the Replication Fork REPLICATION FORK 17

DNA Replication • Helicase enzymes may attach to multiple sites on the DNA strand forming Replication Bubbles which makes replication faster 18

DNA Replication • Single-strand binding proteins attach & STABILIZE the 2 parental strands • DNA polymerase attaches to the 3’ end of the 5’ to 3’ parental strand • DNA polymerase attaches FREE nucleotides to the complementary nucleotide on the parental DNA • This new strand is synthesized continuously 5’ to 3’ (LEADING) 19

Replication Bubble DNA is synthesized from the Origin of Replication within a replication bubble • Towards fork – continuous replication • Away from fork – discontinuous replication (fragments) Origin of Replication 20

DNA Replication Since DNA polymerase can only add nucleotides to the 3’ end of the parental strand, the parental 5’ to 3’ strand must be replicated in fragments that must later be joined together (LAGGING) 21

22

DNA Replication • Transcription proceeds continuously along the 5' 3' direction (This is called the leading strand) • Proceeds in fragments in the other direction (called the lagging strand) in the following way • RNA primer is attached to a segment of the strand by the enzyme primase. 23

DNA Replication • Transcription now continues in the 5' 3' direction forming an okazaki fragment. Until it reaches the next fragment. • The two fragments are joined by the enzyme DNA ligase • Two, new, identical DNA strands are now formed 24

DNA Replication 25

Protein Synthesis Transcription and Translation 26

RNA Transcription • • • The cell does not directly use DNA to control the function of the cell. DNA is too precious and must be kept protected within the nucleus. The Cell makes a working "Photocopy" of itself to do the actual work of making proteins. This copy is called Ribonucleic Acid or RNA differs from DNA in several important ways. 1. It is much smaller 2. It is single-stranded 3. It does NOT contain Thymine, but rather a new nucleotide called Uracil which will bind to Adenine 4. Contains ribose, not deoxyribose sugar 27

RNA Transcription • RNA is produced through a process called RNA Transcription. RNA polymerase combines with region of DNA called a promoter (not transcribed) • Small area of DNA "Unzips" exposing Nucleotides • RNA polymerase initiates synthesis of an RNA molecule in a 5’ to 3’direction • Transcription carried out in a 5’ to 3’ direction 28

Transcription cont. • This area is acted on by an enzyme called RNA Polymerase, which binds nucleotides (using uracil) to their complementary base pair. • This releases a long strand of Messenger RNA (m. RNA) which is an important component of protein synthesis. 29

Sense and antisense strands • Sense strand – coding strand (same sequence as RNA strand) • Antisense strand – template strand (copied during transcription)

The terminator • Sequence of nucleotides that causes the RNA polymerase to detach from the DNA • NTPs pair with antisense strand polymerization of the m. RNA occurs • Portion of transcription known as elongation

Post-transcription processing • Within eukaryotic DNA proteincoding regions there are non-coding regions • Exons – coding regions • Introns – non-coding regions • Introns have to be removed to make a functional m. RNA strand • Prokaryotic m. RNA does not require processing because no introns are present

RNA Transcription 33

Protein Synthesis & The Genetic Code • The Sequence of nucleotides in an m. RNA strand determine the sequence of amino acids in a protein • Process requires m. RNA, t. RNA & ribosomes • Polypeptide chains are synthesized by linking amino acids together with peptide bonds 34

• Each three Nucleotide sequence in an m. RNA strand is called a "Codon“ • Each Codon codes for a particular amino acid. • The codon sequence codes for an amino acid using specific rules. These specific codon/amino acid pairings is called the Genetic Code. m. RNA 35

t. RNA • There is a special form of RNA called Transfer RNA or t. RNA. • Each t. RNA has a 3 Nucleotide sequence on one end which is known as the "Anitcodon" • This Anticodon sequence is complimentary to the Codon sequence found on the strand of m. RNA • Each t. RNA can bind specifically with a particular amino acid. 36

Ribosome • Consists of two subunits made of protein & r. RNA – Large subunit – Small subunit • Serves as a template or "work station" where protein synthesis can occur. 37

Protein Synthesis • First, an m. RNA strand binds to the large & small subunits of a ribosome in the cytosol of the cell • This occurs at the AUG (initiation) codon of the strand. • The ribosome has 3 binding sites for codons --- E (exit site), P, and A (entry site for new t. RNA) • The ribosome moves along the m. RNA strand 38

Protein Synthesis • An anticodon on t. RNA binds to a complementary codon on m. RNA. • The t. RNA carrying an amino acid enters the A site on the ribosome • The ribosome moves down the m. RNA so the t. RNA is now in the P site and another t. RNA enters the A site • A peptide bond is formed between the amino acids and the ribosome moves down again • The first t. RNA is released, and another t. RNA binds next to the second, another peptide bond is formed. • This process continues until a stop codon (UAG…) is reached. • The completed polypeptide is then released. 39

Protein Synthesis 40

41

Replication Problem • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ 42

Answer • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ • 5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’ 43

RNA Transcription Problem • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary m. RNA strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ 44

ANSWER • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary m. RNA strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ • 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’ 45

Codon / Anticodon • Given a m. RNa strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary t. RNA strands? • 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’ 46

Answer Given a m. RNA strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary t. RNA strands? • 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’ • 3’ – UACCACGUGGAUGAGGACUCCUCUUCAGA -5’ 47

Protein Translation • Given the following sequence of m. RNA, what is the amino acid sequence of the resultant polypeptide? • AUGGUGCACCUGA CUCCUGAGGAGAA GUCU 48

Protein Translation / Answer • Given the following sequence of m. RNA, what is the amino acid sequence of the resultant polypeptide? • AUGGUGCACCUGA CUCCUGAGGAGAA GUCU Met-val-his-leu-thr-pro-glu-lys-ser 49

50