DNA Structure and Protein Synthesis also known as

DNA Structure and Protein Synthesis (also known as Gene Expression)

Protein Synthesis • • The process of making proteins… Boring stuff? Nope This is how the information in your genes is used to build… you!

DNA • Deoxyribonucleic Acid (DNA) is found in what part of the cell? Nucleus • How is the DNA organized? Chromosomes!

Each strand of DNA is a POLYMER!! • Individual nucleotides are the monomers! • Monomers (nucleotides) are linked to form a long polymer of single-stranded DNA • In our cells, 2 DNA polymers are bonded together to form a LONG doublestranded polymer

The Parts of a Nucleotide • SUGAR – deoxyribose • Phosphate group (PO 4) • Nitrogen-containing base

A nucleotide

What are the 4 BASES? ADENINE THYMINE CYTOSINE GUANINE

A DNA POLYMER!! • Strong bonds hold the nucleotides together to form a ‘backbone’. • They occur between the sugar of one nucleotide and the phosphate of the next nucleotide.

MORE ABOUT THE BASES… • Adenine always bonds to thymine • Cytosine always bonds to guanine

• Adenine – Thymine (A-T) • Cytosine. Guanine (C-G)

How does DNA Replicate? • DNA replication is making a COPY of ALL the genetic information (ALL the bases of DNA). • This has to happen BEFORE cell division (either Mitosis or Meiosis) can occur. • WHY does it have to happen?

The role of DNA • The material that genes are made of… • Gene - segment of DNA that carries the information necessary to build a protein. • Information is encoded in the sequence (order) of the four DNA bases (ATGC). • A gene is a sequence of thousands of these bases that codes for a protein!

• The DNA in a single human cell = 3, 000, 000 bases (3 Billion!) • However, scientists were surprised that there are only about 30, 000 genes!!

DNA is Double Stranded Molecule • The four bases that make up the genetic code (ATGC) form complimentary pairs. • A pairs with T… G pairs with C. • If one strand is ACGCAATTGCATT • The other is TGCGTTAACGTAA • This makes it possible for DNA copy it’s self…

Make a complementary strand! • TTCCGATCGGCGTATCTGAGCGATCAG…. AAGGCTAGCCGCATAGACTCGCTAGTC

What is a gene? • A Segment of DNA that contains the information that codes for a protein!!!

How do genes result in proteins? • The DNA is in the NUCLEUS of the cell. • Proteins are made on the ribosomeswhere? • In the cytoplasm! • So, the information needs to leave the nucleus…. . • Can the DNA can leave the nucleus?

• NO, it cannot! • The information for the gene needs to be copied in a way that the information CAN leave the nucleus! • This process is the 1 st step in Protein Synthesis- TRANSCRIPTION

Transcription: • The information in the DNA is copied into a molecule of RNA (Ribonucleic acid). • DNA can’t leave the nucleus so …a messenger (copy) is sent. • m. RNA is the messenger.

How is RNA different from DNA? • Monomer is a nucleotide with Ribose sugar, nitrogen base, and phosphate group • In RNA, nitrogen bases are: Adenine, Guanine, Cytosine, and URACIL • Complementary base pairs are C-G; A-U)

• RNA is Single Stranded; DNA is double stranded • DNA: ATGCGTTAC • m. RNA: UACGCAAUG

• http: //www. dnalc. org/resources/3 d/03 mechanism-of-replication-basic. html

Transcribe this DNA sequence! • DNA: GCCTTAAGACATTGTATGCCTAG • Complementary m. RNA: CGGAAUUCUGUAACAUACGGAUC

What are differences between m. RNA & DNA • • Location? Nucleotides? Double stranded? Single Stranded? How much genetic information is contained?

TRANSLATION • What do you do when you go from one language to another? You TRANSLATE! • m. RNA carries the instructions for building the protein • It takes place on the ribosomes (cellular machine that makes the protein by joining amino acids)

Translation • The Sequence (order) of bases in the DNA/RNA determines the order of amino acids in the protein! • The information is translated from the language of DNA/RNA (nucleic acids) to the language of proteins (amino acids).

What does the cell need to translate a m. RNA? • m. RNA- information for making the protein • t. RNA- type of RNA that actually translates the information from nucleic acid (RNA) to amino acid (protein) • Ribosome- the “machine” where translation takes place; binds the m. RNA, t. RNA, and joins the corresponding amino acids (the monomers of proteins!)

How is the m. RNA translated to make a protein? • Correct t. RNA with an amino acid attached “reads” 3 nucleotides (a codon) in the m. RNA and puts the correct amino acid in the growing polypeptide (unfolded protein!). • This happens in the ribosome!!

Summary of transcription and translation • Transcription – A copy of the information in DNA for a gene is encoded into RNA (takes place in nucleus). • Translation – The RNA (messenger) serves as the plan for building a protein using t. RNA as the translator and the ribosome as the “machine” (takes place in cytoplasm)

• http: //www. lewport. com/10712041113402793/lib/107120 41113402793/Animations/Protein%20 Synt hesis%20%20 long. swf