DNA Protein Synthesis Gene to Protein Bacteriophage Griffith
DNA & Protein Synthesis Gene to Protein
Bacteriophage
Griffith • Fredrick Griffith – Trying to find out why bacteria made people sick. – He was studying effects of 2 strains of an infectious bacteria, the "smooth" strain was found to cause pneumonia & death in mice. The "rough" strain did not. He conducted the following experiment
Griffith Experiment Bacteria Strain injected into mouse Result Smooth Strain Mouse dies Rough strain Mouse Lives Heat-Killed Smooth strain Mouse lives Rough Strain & Heat killed smooth strain *MOUSE DIES*
Griffith Experiment • The last condition was unusual, as he predicted that the mouse should live • Grew bacteria from the last dead mouse, and future generations continued to cause disease • Concluded that some unknown substance was Transforming the rough strain into the smooth one • Because of this, concluded that the transforming factor had to be a gene.
Avery, Mc. Carty & Mac. Leod 1952 • Tried to determine which molecule was responsible for transforming agent. Eg. Was it protein or DNA? • Treated phages with enzymes that destroyed either proteins, lipids, carbs, and RNA. Then DNA • Samples with Proteins destroyed would still cause transformation in bacteria indicating genetic material was DNA
Avery, Mc. Carty & Mac. Leod Conclusion: DNA stores and transmits genetic material from one generation of bacteria to the next.
Hershey-Chase • • • What is a bacteriophage? 1 virus was "tagged" with 32 P on it's DNA The other was "tagged" 35 S on it's protein coat.
Three key roles of DNA • The work from these researchers allowed scientists to assume that genes must be capable of : – Storing – Copying – Transmitting • Gene- A “chemical code” for a biological process
Mitosis • Why does the storage of genetic information in genes help explain why chromosomes are so carefully split apart in mitosis?
Bell Work 11/7 Name one scientist who helped discover DNA and what their contribution was? • Objective H. B. 4 A. 1 Develop and use models at different scales to explain the relationship between DNA, genes, and chromosomes in coding the instructions for characteristic traits transferred from parent to offspring.
DNA structure • Scientists originally viewed DNA as little more than a long chain of nucleotides – Did not understand how it was different from other molecules, like proteins. • Sought to understand how the chains are arranged in three dimensions.
DNA • Deoxyribonucleic Acid (DNA) contains the information for life – all the instructions needed to make proteins (including enzymes) • A segment of DNA that controls the production of a protein is called a gene. Hundreds of genes together make up a chromosome. DNA genes chromosomes • DNA is a polymer made up of a chain of nucleotides • Each nucleotide has three parts: – simple sugar (deoxyribose) – phosphate group – Nitrogen base (adenine, guanine, thymine, or cytosine)
Nucleotide types: • For DNA There are 4 different Nucleotides categorized as either Purines or Pyramidines. These are usually represented by a letter. These Are: 1. 2. 3. 4. Adenine (A) Cytosine (C) Guanine (G) Thymine (T)
Chargoff’s rule • Discovered that the percent of A and T bases are nearly the same regardless of the amount of DNA. – Same with C and G • Other organisms had the same observations. – He had no idea why this was. – If a species has 35% adenine, how much of the other bases does it have? A = _____ T= ______ C = ______ G = ______
Rosalind Franklin ‘ 52 • “Stretched” out DNA in a glass tube • Shot a powerful x-ray beam through the DNA – Did not show the structure By itself – Suggested that there were Two strands that were twisted “Helix”
Watson & Crick • Worked at the same time as Franklin. • Were trying to build a 3 D DNA model using cardboard and wire. – Could not figure it out. • In 1953 - Watson was shown a copy of Franklin’s xray and they instantly understood the double – helix structure that DNA formed.
DNA Structure • DNA is Formed of in a "Double Helix" - like a spiral staircase
Ladder analogy • Which part is the steps? • Which part forms the sides?
Base Pairing • Each “Step" of the DNA "staircase" is formed by Hydrogen Bonds. – Why weak bonds? • These Hydrogen bonds form only between specific Nucleotides. This is known as Base Pairing. The rules are as follows: – Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen bonds) – Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen bonds)
Bell Work 11/3 What are three differences between DNA and RNA? • Objective H. B. 4 A. 2 Develop and use models to explain how genetic information (DNA) is copied for transmission to subsequent generations of cells (mitosis).
It is estimated that the human body contains about 50 trillion cells - which works out to 100 trillion meters of DNA per human. This means that each of us has enough DNA to go from here to the Sun and back more than 300 times. "
“Antiparallel” strands • The two identical chains of DNA run in opposite directions. • 5’ has the free phosphate group • 3’ has a free OH • DNA replication can only go from 5’ -> 3’
DNA 3 D Structure Single ring nitrogen bases always bind with a double ring nitrogen base: Adenine to Thymine Cytosine to Guanine Nucleotide
DNA folding
DNA folding Histones- “The proteins that allow DNA to begin folding “spools” Nucleosomes- histone + DNA wrapped around it. - “beads on a string” Chromosome- tight folding of nucleosomes.
DNA Replication • Each strand of DNA serves as a template for a new strand of DNA “complementary” strands – 2 strands unwind. – Exact copy made • 2 new strands form using Base pairing. – DNA replicates itself exactly so that each new cell will have an identical copy of the original DNA. • S PHASE
DNA enzymes • DNA helicase – Unwinds the DNA strand • DNA polymerase- Adds nucleotides to the chain – Always from 5’ to 3’ – Also proofreads DNA • DNA Ligase- Attaches replicated segments of DNA together to form long chain.
DNA replication
DNA Replication • DNA "Unzips itself" forming two strands with exposed Nucleotides • DNA Polymerase adds the appropriate nucleotide to the sequence • The process moves down the DNA molecule, and once complete, results in two identical DNA strands. • Transcription proceeds continuously along the 5' 3' direction – Called leading strand • Proceeds in fragments in the other direction (called the lagging strand) – Transcription now continues in the 5' 3' direction forming an okazaki fragment. Until it reaches the next fragment. – The two fragments are joined by DNA ligase
Bell Work 11/4 What are the major steps of DNA replication • Objective H. B. 4 A. 2 Develop and use models to explain how genetic information (DNA) is copied for transmission to subsequent generations of cells (mitosis).
DNA Replication
Enzymes of DNA replication • DNA Helicase- unwinds strands by cutting H bonds • DNA Primase- tells where to start replication • DNA Polymerase- “Reads” the DNA code to add the correct bases • DNA ligase- “seals” up the new double stranded DNA
Prokaryotic versus Eukaryotic • Pro- single DNA strand – Starts at a single spot and proceeds in both directions until the entire chromosome is completed. • Euk- Replication begins at dozens or hundreds of places- proceeding in both directions until each chromosome is completed.
Replication Problem • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’
Answer • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ • 5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’
Telomeres • A region of repeating nucleotide sequences at the end of chromosomes. – TTAGGG – Protects from deterioration • Shorten with age. – Shortening has been associated with cancer. • Smoking is shown to accelerate the shortening
Bell Work 11/9 What is the difference between the leading and lagging strand of DNA replication? • Objective H. B. 4 B. 1 Develop and use models to describe how the structure of DNA determines the structure of resulting proteins or RNA molecules that carry out the essential functions of life.
Central dogma of genetics • Central Dogma holds that genetic information is expressed in a specific order. This order is as follows There are some apparent exceptions to this. Retroviruses (eg. HIV) are able to synthesize DNA from RNA
Bell Work 11/7 What is the central dogma of genetics • Objective H. B. 4 B. 2 Obtain, evaluate and communicate information on how biotechnology (including gel electrophoresis, plasmid-based transformation and DNA fingerprinting) may be used in the fields of medicine, agriculture, and forensic science.
Processes and Code Transfer • Replication – copies DNA to make another identical double strand of DNA • Transcription – makes a copy of a section of DNA and creates a single strand of m. RNA • Translation – reads the sequence of m. RNA nucleotides to build a protein
RNA Transcription • • • The cell does not directly use DNA to control the function of the cell. DNA is too precious and must be kept protected within the nucleus. The Cell makes a working "Photocopy" of itself to do the actual work of making proteins. This copy is called Ribonucleic Acid or RNA differs from DNA in several important ways. 1. It is much smaller 2. It is single-stranded 3. It does NOT contain Thymine, but rather a new nucleotide called Uracil which will bind to Adenine. 4. It contains ribose
RNA • DNA is the “master plan” – It doesn’t leave the nucleus • RNA is like a disposable copy of the master plan – It can leave the nucleus. – Travel to the ribosomes
Types of RNA • Messenger RNA- carry the “recipe” from the gene to the ribosome to make a protein. • Ribosomal RNA- forms the ribosomes • Transfer RNA- Carries amino acids to the ribosome and matches them to the Mrna message
DNA Fingerprinting • Restriction enzymes “endonucleases” – Bacterial enzymes that cut DNA into pieces when they read a specific sequence of DNA • Ex. CCGG -> CC | GG • Normally provide a defense for bacteria against invading viruses while leaving the bacterial DNA safe. • Polymerase Chain Reaction- DNA that is cut is amplified “many copies made” • Gel Electrophoresis- cut strands are separated out
DNA Fingerprinting
RNA Transcription • Segments of DNA “genes” serve as templates to make m. RNA. – Pro in cytoplasm, Euk in nucleus • RNA Polymerase, which binds nucleotides (using uracil) to their complimentary base pair. • This releases a long strand of Messenger RNA (m. RNA) which is an important component of protein synthesis.
Bell Work 11/9 What are used to cut DNA into segments called • Objective H. B. 4 B. 2 Obtain, evaluate and communicate information on how biotechnology (including gel electrophoresis, plasmid-based transformation and DNA fingerprinting) may be used in the fields of medicine, agriculture, and forensic science.
RNA transciption • Promoters- tells RNA polymerase where to start replicating – Specific base sequences. • Introns- regions of DNA that are cut out – Not used for protein • Exons- regions that are used. – “Spliced” together
Exon splicing
Nucleic Acids and Protein Synthesis • All functions of a cell are directed from some central form of information. • This "biological program" is called the Genetic Code. - The way cell store information regarding it's structure and function.
Chapter 10 Genetic Code • The nearly universal genetic code identifies the specific amino acids coded for by each three-nucleotide m. RNA codon. The Human Genome: The entire gene sequence of the human genome, the complete genetic content, is now known. Approximately 30, 000 genes.
m. RNA • Each three Nucleotide sequence in an m. RNA strand is called a "Codon" Each Codon codes for a particular amino acid. • Remember- there are 20 AA’s
Protein Synthesis= Translation • Protein synthesis is a complex, many step process, it is as follows. – An m. RNA strand binds a ribosome in the cytoplasm of the cell • This occurs at the AUG (initiation) codon of the strand. – A t. RNA molecule with an attached amino acid binds to the m. RNA strand. • Note: This occurs with complimentary codons & anti-codons. – Another t. RNA binds to the adjacent codon of the m. RNA – A peptide bond is formed between the amino acids – The first t. RNA is released, and another t. RNA binds next to the second, another peptide bond is formed. – This process continues until a stop codon is reached. – The completed polypeptide is then released.
Transfer RNA • Anticodon- each trna has 3 unpaired bases, called an anticodon. – Each one carries just one type of AA
RNA Transcription Problem • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary m. RNA strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’
ANSWER • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary m. RNA strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ • 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’
Codon / Anticodon • Given a m. RNa strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary t. RNA strands? • 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’
Protein Translation • Given the following sequence of m. RNA, what is the amino acid sequence of the resultant polypeptide? • AUGGUGCACCUGA CUCCUGAGGAGAA GUCU
Protein Translation / Answer • Given the following sequence of m. RNA, what is the amino acid sequence of the resultant polypeptide? • AUGGUGCACCUGA CUCCUGAGGAGAA GUCU Met-val-his-leu-thr-pro-glu-lys-ser
Translate the following AAs • CAG AUU AUG CCG AAC G UUA A CUU T • Use your genetic code to translate the codons into the corresponding letters to crack the code!
Bell Work 11/10 What are the two main categories of mutations in a gene? What is the difference? • Objective H. B. 4 B. 2 Obtain, evaluate and communicate information on how biotechnology (including gel electrophoresis, plasmid-based transformation and DNA fingerprinting) may be used in the fields of medicine, agriculture, and forensic science.
RNA transciption • Promoters- tells RNA polymerase where to start replicating – Specific base sequences. • Introns- regions of DNA that are cut out – Not used for protein • Exons- regions that are used. – “Spliced” together
Exon splicing
Splicing • Splicing means to cut away the intron regions of the DNA and connected the desired segments of DNA. – Advantage is that single strand of Mrna can create – 30, 000 genes can encode the 120, 000 different translated m. RNA in human cells.
Protein Secretion • The polypeptide chain that is made during translation is sent to the endoplasmic reticulum (ER) for any further structural components • Golgi bodies package the protein and send it to the cell membrane • The protein is then secreted from the cell and sent where the body needs it http: //courses. washington. edu/conj/cell/secretion. htm
Bell Work 11/10 MRNA = U A C C G A U C G Which nucleotide DNA sequence would produce this? • Objective H. B. 4 B. 1 Develop and use models to describe how the structure of DNA determines the structure of resulting proteins or RNA molecules that carry out the essential functions of life.
Mutations • If the m. RNA does not copy the code correctly, the amino acid chain will be altered – this is called a mutation
Types of mutations • Point mutations- one or several nucleotides change. – Substitutions- one base changed to another. - Change one AA or maybe no change at all – Frameshift mutations – adding or removing a nucleotide • Shifts the codon “reading” and can change every amino acid after it.
Mutations • Can range from no effect to affecting the entire species • Occurs roughly 1 in 10 million times – Can sometimes be beneficial • Mutagens- Pesticides/ x rays/ tobacco smoke/ UV light
Sickle Cell Negative : anemia, pain, infections Positive : malaria resistance
Biotechnology • The use of living organisms in industrial, agricultural, medical, and other applications.
Genetic Modifications - Plants
Bell Work 11/11 Explain why a frameshift mutation is more dangerous that a substitution? • Objective H. B. 4 B. 2 Obtain, evaluate and communicate information on how biotechnology (including gel electrophoresis, plasmid-based transformation and DNA fingerprinting) may be used in the fields of medicine, agriculture, and forensic science.
Test – Monday • DNA Structure – Monomer: Nucleotides – Polymer: DNA /RNA – Organization: wraps around histone proteins to form nucleosomes. • Chromatin- Interphase- unorganized nucleosomes • Chromosomes – Mitosis – coils like a spring
Test – Monday • Scientists – Griffith, Avery, Watson and Crick , Franklin, Hershey Chase, Chargoff • RNA – 3 types • Mrna- nucleus to ribosome • t. RNA – brings AA to correct spot • r. RNA- makes up the ribosomes – 4 differences between RNA and DNA
Test- Monday • DNA Replication – DNA Helicase unwinds hydrogen bonds – DNA polymerase adds bases • Leading- continuous replication 5’ – 3’ • Lagging – Okasaki fragments , noncontiguous – DNA ligase “glues” it together – Transcription versus Translation versus Replication
Test- Monday • Take DNA -> Protein • Take Protein -> DNA • Analyze mutations and predict effect
Genetic Modifications - Plants • Why are we modifying them in the first place? – Pesticide resistance – Drought resistance – Disease resistance – Increased Milk production- 30% hormones – Ex. “golden” rice- modified to produce more beta-carotene.
Genetic Modifications – Other uses • Insulin – Previously was obtained from a pig pancreas. • Production of vaccines- – Ex. Yeast- modified to produce hepatitis B vaccine antibodies • Cloning- making identical copy of an organism.
Cloning
Genetic Modification • Transgenic organism- Organisms whose DNA contains genes of other species.
- Slides: 83