Genomic Analysis of Marine Viruses Tucson High School

































- Slides: 33
Genomic Analysis of Marine Viruses Tucson High School Biotechnology Course Spring 2010
What do marine viruses do? Infect and Kill
What do marine viruses do? Transfer Genes + + Ex: Photosynthesis genes!! 1028 base pairs of DNA per year in world’s oceans 10, 000, 000, 000
What do marine viruses do? Alter their hosts + Vibrio cholerae Cholera toxin
What do they infect? What genes do they transfer? How do they alter their host?
We need to use genetics… UNIVERSAL genes Bacteria have 16 S gene Eukaryotes have 18 S gene NO universal gene for viruses!!
So we use CONCERVED genes
How will WE use genetics? … to find out what type of virus we have. psb. A Myovirus Podovirus X X X DNA pol g 23 X
PCR Forward primer DNA pol Reverse primer standard psb. A DNA g 23 pol
How will WE use genetics? … to find out what type of virus we have. psb. A Myovirus Podovirus X X X DNA pol g 23 X
Transmission Electron Microscope e- e- e- Myovirus ? ? ?
What then? PCR only tells us PRESENCE or ABSENCE DNA Sequencing atatggatcgagcttgac A string of letters… yay. We need BIOINFORMATICS!
Bioinformatics and Genomics Bonnie Hurwitz Graduate student TMPL
What can you do with a sequence? Gene Sequence Align it with gene sequences from other species Create a phylogeny showing how closely related species are to one another
Understand Functionally Meaningful Genetic Diversity 15 T 4 -like myoviruses from a diversity of hosts 100/100 NATL 2 A 100/100 SS 120 MIT 9303 MIT 9313 MIT 9302 MIT 9201 MIT 9312 MIT 9401 AS 9601 SB MIT 9314 MIT 9301 MIT 9215 RS 810 MIT 9107 MB 11 F 02 MB 11 E 08 High light Prochlorococcus MED 4 MIT 9515 MIT 9211 100/98 GP 2 PAC 1 NATL 1 A Low light Prochlorococcus RS 8015 WH 8406 WH 8112 100/88 WH 8102 69/-- WH 8103 MB 11 A 04 MB 11 E 09 EBAC 392 100/98 97/94 WH 6501 WH 8012 99/64 89/83 WH 8005 WH 8002 WH 8109 100/99 70/-- 59/-- 66/ -100/98 95/93 WH 5701 Marine Synechococcus WH 8020 WH 9908 WH 8015 MIT S 9220 WH 8017, WH 8018 RS 9705 WH 7803 WH 8101 0. 1 substitutions per position PCC 6307 Rocap et al. 2002. AEM
What can you do with a lot of sequences? What is a (meta)genome?
isolate community sequencing Genomics Metagenomics
Genome assembly
Genome assembly
Shotgun sequencing (WGS) genomic DNA sheared clone library (insert sizes of 1 -2, 34, 30 -40, 100 kb) end sequence clones (f / r) …ACGGCTGCGTTACATCGATCATTTACGATACCATTG… assemble reads by alignment identity
Genome scaffolding contig A B D E C G F H break mate pair linkage 4 3 7 6 8 5 2 G H 1 A B E’ “composite” genome scaffold C D F E’’
Genome annotation is never done …
The first four Prochlorococcus cyanophage genomes P-SSM 4 “bacterial” 15% - variations on coliphages (e. g. , T 4, T 7 1 and “lambda” 2) - contain core photosynthesis genes 3, 4: - expressed during infection 5, 6 - diversity generator for their hosts 4 - comprise ~60% of surface ocean microbial psb. A genes 7 Cyano 11% T 4 -like 14% “phage” Hypothetical 60% - contain other ‘host’ genes (Auxilliary Metabolic Genes = AMGs 8) … phycobilin biosynthesis, P stress, C metabolism, nucleotide metabolism 1 References: 1 Sullivan et al. 2005. PLo. S Biol. , 2 Sullivan et al. in prep. , 3 Lindell & Sullivan et al. 2004. PNAS, 4 Sullivan & Lindell et al. 2006. PLo. S Biol. , 5 Lindell et al. 2005. Nature, 6 Lindell et al. 2007. Nature, 7 Sharon et al. 2007. ISMEJ , 8 Breitbart, Thompson, Suttle & Sullivan. 2007. Oceanography
Metagenome assembly
Metagenome assembly
Metagenome assembly
Community complexity Acid mine drainage 1 10 Sargasso Sea 100 Species complexity Soil 10000
Community genomics (a. k. a. metagenomics) Environmental Sample Extract DNA Clone High throughput sequence Sheared Size selection Library Type: Shotgun (small-insert) 3 kb Fosmid (large-insert) 40 kb BAC (large-insert) BIG STUFF! Assemble reads Call genes Bin fragments
What to do with the data? EGTs = Environmental Gene Tags Predict ORFs (genes) in sequence data Assign a function to ORFs Compare relative abundance across habitats
Metagenomics is but the first level protein proteome RNA transcriptome DNA genome viruses bacteria & archaea microbial communities eukaryotes
Summary • The smallest but arguably most important ocean inhabitants are microbes and phages • Using metagenomics to sequence previously undetectable microbes and phages has expanded our knowledge of the oceans’ ecosystems • Looking a genes in genomes can give us an idea of the potential function and role these organisms play in ocean ecology • Looking at gene expression can tell us which genes are playing an active role in the ecosystem and who the major players are
Our goals • Assemble and annotate a phage genome – Next Tuesday and Thursday • Build a gene phylogeny and determine what phage you have based on it’s relationship to other phages – April 6 th
higher trophic levels grazers phytoplankton Dissolved bacteria viral lysis