Acquired alterations of IG and TCR loci in

Acquired alterations of IG and TCR loci in lymphoproliferative disorders Sabine Franke, Ph. D Sabine. Franke@chu. ulg. ac. be CHU Ulg Liège, Centre for Human Genetics Interuniversity course 2017/18 - HUMAN GENETCIS 20. April 2016 ULG

Overview n What are lymphoproliferative disorders? n What are ‘IG’ and ‘TCR’? n What are IG/TCR alterations? n How to detect IG/TCR alterations?

Overview n What are lymphoproliferative disorders? n What are ‘IG’ and ‘TCR’? n What are IG/TCR alterations? n How to detect IG/TCR alterations?

Blood cell development major types of lymphocytes

Three major types of lymphocytes n B cells n T cells n Natural killer (NK) cells

Function of B and T cells n B cells are primary responsible for humoral immunity (relating to antibodies) n T cells are involved in cell-mediated immunity.

B-cells n Millions of different types of B cells each day n In the blood and lymphatic system role of immune surveillance n No production of antibodies until fully activated

1) Combinatorial diversity (Somatic recombination) 2) Junctional diversity (Inaccurate junction) 3) Somatic hypermutation (Affinity maturing in germinal centres)

Gene rearrangements of the antigen receptor genes occur during the lymphoid proliferation

Lymphoproliferative disorders (LPDs) LPDs refer to several conditions in which lymphocytes are produced in excessive quantities. n n n n n Chronic lymphocytic leukemia (most frequent) 25% Acute lymphoblastic leukemia Hairy cell leukemia lymphomas Multiple myeloma Waldenstrom’s macroglobulinemia Wiskott-Aldrich syndrome Post-transplant lymphoproliferative disorder Autoimmune lymphoproliferative syndrome (ALPS) ‘Lymphoid interstitial pneumonia’

B, T, and NK lineage of lymphoid malignancies Lymphoid malignancy B lineage T lineage Acute lymphoblastic leukemia – children 82 – 86% – adults 75 – 80% 14 – 18% 20 – 25% Chronic lymphocytic leukemias 95 – 97% 3 – 5% Non-Hodgkin lymphomas – nodal NHL – extranodal NHL – cutaneous NHL Multiple myeloma 95 – 97% 90 – 95% 30 – 40% 100% 3 – 5% 5 – 10% 60 – 70% 0% NK lineage < 1% 1 – 2% < 2% 0%

1. Take home message n Three major types of lymphocytes n In LPDs lymphocytes are produced in excessive quantities n Different lymphoid malignancies of different lineage origin

Overview n What are lymphoproliferative disorders? n What are ‘IG’ and ‘TCR’? n What are IG/TCR alterations? n How to detect IG/TCR alterations?

B-cell and T-cell receptors Image source: Immunobiology, 5 th edition Janeway et al

Structure of the B-cell receptors The BCR is a membrane-bound immunoglobulin, and allows the distinction of B cells from other types of lymphocytes and is the main protein involved in B cell activation.

The ability to produce billions of different antibodies in humans results from the production of variable regions of light and heavy antibody genes by DNA rearrangement. Heavy chain (IGH) Light chain (IGL) The five major classes of heavy chain are Ig. M, Ig. G, Ig. A, Ig. D, and Ig. E. http: //www. biology. arizona. edu

Schematic representation of an Immunoglobulin (IG)

Structur of the T-cell receptor Image source: Immunobiology, 5 th edition Janeway et al

T-cell receptor gene rearrangement The variable domain of both the TCR α-chain and β-chain have three hypervariable or complementary determining regions (CDRs) n n Receptor for antigen on the majority of mature T-cells consists of two polypeptides alpha and beta that are linked by disulphide bonds and are associated with CD 3 A small population of mature T-cells express a different TCR heterodimer in association with CD 3. This is composed of two polypeptides designated gamma and delta

2. Take home message n Structure of the B and T cell receptor is important n Ig and TCR consists of a variable and a constant region n Ig consists of heavy and light chains

Overview n What are lymphoproliferative disorders? n What are ‘IG’ and ‘TCR’? n What are IG/TCR alterations? n How to detect IG/TCR alterations?

The production of variable regions of light and heavy antibody genes by DNA rearrangement.

The production of variable regions of heavy antibody genes by DNA rearrangement. stepwise rearrangement of V, D, and J gene segments Genes encoding antigen receptors are unique: -high diversity -developing lymphocytes through V(D)J rearrangement.

n These V-J gene rearrangements generate products that are unique in length and sequence in each cell resulting in diverse antigen expressing B cells.

B cell development

Cell development. Stage Heavy chain Light chain Progenitor (or pre-pro) B cells germline Early Pro (or pre-pre)-B cells undergoes D-J rearrangement germline Late Pro (or pre-pre)-B cells undergoes V-DJ rearrangement germline Large Pre-B-cells is VDJ rearranged germline Small Pre-B cells is VDJ rearranged undergoes V-J rearrangement Immature B cells is VDJ rearranged VJ rearranged Mature B cells is VDJ rearranged VJ rearranged

T cell rearrangement

Estimated diversity of human Ig and TCR molecules Number gene segments V gene segments D gene segments J gene segments Ig. H Igα Ig ג molecules ~44 27 6 ~43 Combination diversity Junctional diversity Total diversity 5 ~38 4 >2 x 10 6 ++ + >10 12 TCR α β γ δ molecules ~46 ~47 2 53 13 2 x 10 6 + + >10 12 ++ ~6 ~6 3 5 4 <5000 ++ ++++ >10 12

Possible variation through recombining gene fragments? Over 15, 000 combinations of variable, diversity and joining gene segments are possible. Imprecise recombination and mutation increase the variability into billions of possible combinations.

3. Take home message n Gene rearrangements of the antigen receptor genes occur during the lymphoid proliferation n B-cells: Stepwise rearrangement of V, D, and J gene segments n Unique products of V(D)J rearrangements resulting in diverse antigen expressing B-cells

Overview n What are lymphoproliferative disorders? n What are ‘IG’ and ‘TCR’? n What are IG/TCR alterations? n How to detect IG/TCR alterations?

Clinically relevant testing • B-cell versus T-cell malignancy (origine) • Reactive versus malignant • New lymphoma versus recurrence • Assessment of remission and relapse • Bone marrow involvement • Evaluation of treatment effectiveness

Analysis Techniques n Detecting gene rearrangements of the antigen receptor genes n Discrimination between monoclonal and polyclonal Ig/TCR gene PCR products

PCR Discrimination between monoclonal and polyclonal Ig/TCR gene PCR products n n Gene. Scanning analysis Fast, accurate, sensitive non-quantitative monitoring of clonal proliferation Need sequence equipment Heteroduplex analysis Sensitivity ~5 -10% available to most laboratories

Design of novel primer sets for detection of Ig/TCR rearrangements BIOMED-2 study (multiplex PCR) Ig genes: IGH: IGK: IGL: VH-JH and DH-JH V -J and Kde rearrangements V -J TCR genes: TCRB: V -J and D -J TCRG: V -J TCRD: V -J , D -D , D -J , and V -D

BIOMED-2 clonality strategy Suspected B-cell lymphoma IGH V(D)J FR 1, FR 2, FR 3 IGH DJ(A) IGK-VJ and DE Suspected lymphoma of unknown origin Suspected T-cell lymphoma TCRGVJ (A and B) TCRB V(D)J (A and B) TCRB DJ

CTGTGCAAGAGCCTCTCTCCACTGGGATCGGGGCCCTTTGACTACTGG CTGTGCAAGAGCCTCTCTCCACTGGGATCGGGGCCCTTTGACTACTGG CTGTGCAAGAGCCTCTCTCCACTGGGATCGGGGCCCTTTGACTACTGG ………. . CTGTGCAAGAG Van Dongen et al Leucemia 2003

U. Hershberg et E. T. Luning Prak 2015

CTGTGCAAGAGCCTCTCTCCACTGGGATCGGGGCCCTTTGACTACTGG CTGTGCAAGAGCCTCTCTCCACTGGGATCGGGGCCCTTTGACTACTGG CTGTGCAAGAGCCTCTCTCCACTGGGATCGGGGCCCTTTGACTACTGG Van Dongen et al Leucemia 2003

Van Dongen et al Leucemia 2003

PCR Gene. Scan analysis region

Example BIOMED-2 multiplex IGH VH-FR 2–JH Use of controls

Analysis of TCRB gene rearrangements

Analysis of TCRB gene rearrangements

From the patient to the analysis n Selection of material n Protocol n Check DNA quality n Clonality analysis

Examples of cases n Case 1: Lymphoma? Reactive? n Case 2: Relapse? n Case 3: T-cell lymphoma

Case 1 n n n Female 63 years Lymphoma in dec. 2004 FR 1 polyclonal, FR 3 monoclonal Feb. 2009 biopsy Relapse?

Case 1: Gene. Scan analysis of controls H 2 O

Case 1: Relapse? FR 3 2/2009 Biopsie FR 3: 152 bp 12/2004 Biopsie FR 3: 152 bp 2000 600

Case 1: Results Controls ok B-cell targets: IGH(VDJ) FR 3 clonal Conclusion of the molecular results: Clonal rearrangement of the IGH gene was detected in this specimen. This gene rearrangement profile is identical to the one detected in the biopsie of 12/2004 and confirms the relapse of the disease.

Case 2 n n Female 81 years Biopsie Lymphoma?

Case 2 2700 100 3/2009 biopsie FR 1 327, 11 bp control

Case 2: Results Controls ok B-cell targets: IGH(VDJ) FR 1 monoclonal FR 2 monoclonal Conclusion of the molecular results: Clonal rearrangements of the IGH gene were detected in this specimen. This gene rearrangement profile fits to the presense of a monoclonal B-cell population/B-NHL.

Case 3: Male 75 years Lymphoma origine? 2 biopsies First results: FR 1, 2, 3 kappa polyclonal

Case 3: TCRG

Case 3: TCRG

Use of clonality analysis 1. Making the diagnosis Normal reactive malignant 2. Assessment of remission and relapse Normal reactive malignant 3. Involvement (staging) 4. Evaluation of treatment effectiveness Detection of minimal residual disease (MRD) MRD-based risk-group stratification (treatment reduction or treatment intensification)

4. Take home message n n n Gene rearrangements of the antigen receptor genes occur during the lymphoid proliferation These gene rearrangements generate products that are unique in length and sequence in each cell. In a clonal population (from one cell) all cells have the identical gene rearrangement. Unique length allows by PCR discrimination of monoclonality and polyclonality Standardized protocol