DNA Fingerprinting Gel Electrophoresis Sometimes we comparing DNA

DNA Fingerprinting Gel Electrophoresis

Sometimes we comparing DNA from two or more sources. BUT it would take too long to compare all of it!

Most of our DNA is identical to DNA of others. BUT there are inherited regions of our DNA that can vary from person to person called "polymorphisms”

There a class of DNA polymorphisms known as "Short Tandem Repeats“ (STRs. )

STRs sequences of DNA, normally 2 -5 base pairs, which repeat numerous times "gatagata” “gata” different for each individual

These small segments of DNA are “cut” out by certain restriction enzymes for comparason

restriction enzymes are isolated from bacteria that recognize specific sequences of DNA cut it into fragments, called restriction fragments. http: //www. dnalc. org/view/15476 -Genetic-engineering-insertingnew-DNA-into-a-plasmid-vector-3 D-animation-with-basicnarration. html

Short Tandem Repeat sequences (STRs) are similar to VNTRs in that they involve tandem repeats of a core sequence in variable numbers among the population to produce a polymorphic distribution. The major difference is that the core sequence is usually only 3 or 4 nucleotides in length (VNTR core sequences can be 16 or more nucleotides).

Usually a tighter range of alleles results. The small size of the STRs used in forensic DNA profiling (amplimers range from 100 - 500 bp) allows for more efficient amplification by PCR also allows the use of DNA that has been degraded more significantly because even small pieces of DNA may contain intact STR sites. Primers are designed to anneal to sequences in the DNA that flank the STR.

PCR Amplification of the material between the primer locations includes the STR region. Therefore, any allelic differences between individuals will be evidenced by different lengths for the amplification product among individuals tested.

Many uses of restriction enzymes… § Now that we can cut DNA with restriction enzymes… we can cut up DNA from different people… or different organisms… and compare it u why? u § § § forensics medical diagnostics paternity evolutionary relationships and more…

Comparing cut up DNA § How do we compare DNA fragments? u separate fragments by size § How do we separate DNA fragments? run it through a gelatin u gel electrophoresis u § How does a gel work?

Gel electrophoresis § A method of separating DNA in a gelatin-like material using an electrical field DNA is negatively charged u when it’s in an electrical field it moves toward the positive side u DNA – “swimming through Jello” +

Gel electrophoresis § DNA moves in an electrical field… u so how does that help you compare DNA fragments? § size of DNA fragment affects how far it travels w small pieces travel farther w large pieces travel slower & lag behind DNA – “swimming through Jello” +

Gel Electrophoresis DNA & restriction enzyme - longer fragments wells power source gel + completed gel shorter fragments

fragments of DNA separate out based on size Running a gel cut DNA with restriction enzymes 1 2 Stain DNA u u ethidium bromide binds to DNA fluoresces under UV light 3

DNA fingerprint § Why is each person’s DNA pattern different? u sections of “junk” DNA § doesn’t code for proteins § made up of repeated patterns w CAT, GCC, and others w each person may have different number of repeats § many sites on our 23 chromosomes with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA GCTTGTAACGGCATCATCATCCGGCCTACGCTT CGAACATTGCCGTAGTAGTAGGCCGGATGCGAA

DNA patterns for DNA fingerprints Allele 1 cut sites repeats cut sites GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA Cut the DNA GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTT CGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGAA 1 2 – DNA allele 1 3 +

Differences between people Person 1 cut sites GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA Person 2: more repeats GCTTGTAACGGCCTCATCATCATCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAGGCCGGATGCGAA 1 2 DNA fingerprint – DNA person 1 person 2 http: //en. wikipedia. org/wiki/Restriction_enzyme 3 +

Uses: Evolutionary relationships § Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel fruitfly – DNA + 1 2 3 4 5

Uses: Medical diagnostic § Comparing normal allele to disease allele chromosome with normal allele 1 chromosome with disease-causing allele 2 all ele 1 all ele 2 – DNA Example: test for Huntington’s disease +

Uses: Forensics § Comparing DNA sample from crime scene with suspects & victim suspects S 1 S 2 S 3 crime scene V sample – DNA +

DNA fingerprints § Comparing blood samples on defendant’s clothing to determine if it belongs to victim u DNA fingerprinting

RFLP / electrophoresis use in forensics § 1 st case successfully using DNA evidence u 1987 rape case convicting Tommie Lee Andrews “standard” semen sample from rapist blood sample from suspect “standard”

Electrophoresis use in forensics § Evidence from murder trial u Do you think suspect is guilty? blood sample 1 from crime scene blood sample 2 from crime scene blood sample 3 from crime scene “standard” blood sample from suspect OJ Simpson blood sample from victim 1 N Brown blood sample from victim 2 R Goldman “standard”

Uses: Paternity § Who’s the father? Mom F 1 – DNA + F 2 child

Simulated Gel Electrophoresis Lab Who Murdered Jon. Benet Ramsey? ? Your “chart” (paper) represents the “gel”

Biology Names: ______________ Simulated gel electrophoresis Lab Pd. ____ Date: _______ DNA Fingerprint “Gel” Sheet Sperm Bank DNA Father 1 Father 2 Father 3 Number of Base Pairs (bp) 1 2 3 4 5 6 7 8 9 10 11 Remember the smaller ones move farther than the bigger ones 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

DNA sequences:

ANALYSIS: 1. On your chart, label the positive (+) and the negative (-) ends. READ THE INSTRUCTION PAGE THE ANSWER IS THERE!!!! Circle the suspects DNA that matches the CRIME SCENE DNA and write his name: REAL FATHER = For each of the following tasks performed in this “simulated” lab, describe what it is actually simulating. 2. Cutting the DNA into fragments with scissors: 3. Moving and taping the DNA onto the evidence sheet simulates what step in the actual process? What is: 4. A Polymerase Chain Reaction: 5. Gel Electrophoresis: 6. A Restriction Enzyme: