Gel Electrophoresis What is Gel Electrophoresis Electrophoresis Movement

Gel Electrophoresis

What is Gel Electrophoresis? • Electrophoresis: Movement of charged particles through a solution (gel) under the influence of an electric field • DNA fragments have a negative (-) charge and will move toward the positive electrode

The Basic Components • The “gel” in gel electrophoresis is the component that physically separates the molecules. • The electric power supply provides the electricity that carries the molecules through the gel

• The gel is placed in the electrophoresis chamber. • Gel acts like a bridge through which the molecules must travel to get from one side of the chamber to the next.

DNA Preparation Restriction Enzymes • Cut DNA into small pieces • Restriction enzymes recognize specific sequences in the DNA molecule (for example GATATC) and cuts the DNA wherever that specific sequence occurs.

The electrophoresis: After all the DNA samples have been loaded into the wells, the electrodes are connected to the power supply. When the power is turned on, the negatively charged molecules move through the gel toward the positive pole (Remember: Opposites do Attract!!). DNA fragments have a negative charge.

http: //www. life. uiuc. edu/molbio/geldigest/electro. html#run

http: //www. life. uiuc. edu/molbio/geldigest/electro. html#run

Applications of Gel Electrophoresis • DNA – Criminal investigations • • Blood Saliva Hair Semen – Paternity Tests

Forbidden Donut Mystery • Your Analysis Unit is charged to determine who took a bite of Homer’s Forbidden Donut. – Posterboard = ? – Names on the Posterboard = ? – Scissors = ? – DNA strips from suspects

Forbidden Donut Mystery • Your Analysis Unit is charged to determine who took a bite of Homer’s Forbidden Donut. – Posterboard = GEL – Names on the Posterboard = ? – Scissors = ? – DNA strips from suspects

Forbidden Donut Mystery • Your Analysis Unit is charged to determine who took a bite of Homer’s Forbidden Donut. – Posterboard = GEL – Names on the Posterboard = WELLS – Scissors = ? – DNA strips from suspects

Forbidden Donut Mystery • Your Analysis Unit is charged to determine who took a bite of Homer’s Forbidden Donut. – Posterboard = GEL – Names on the Posterboard = WELLS – Scissors = RESTRICTION ENZYME – DNA strips from suspects

Forbidden Donut Mystery • How to cut and place sequences on gel AGTCCGGCATTATCGGCGATCGA TCAGGCCGTAATAGCCGCTAGCT 2 2 2 4 12 2 12 6