Exons and Introns Chesley Leslin Steps in Production
- Slides: 11
Exons and Introns Chesley Leslin
Steps in Production Proteins • exons: the sequences in the DNA molecule that code for the amino acid sequences of corresponding proteins. • intron: the DNA sequence in a eukaryotic gene that is not translated into a protein. • Transcription – DNA – pre. RNA - m. RNA • Translation – m. RNA - Proteins
What do we need for transcription? 1. DNA In eukaryotes, the genome is divided into : • Non-coding areas. . . between genes. • Genes : Each gene is divided into several exons, separated by non coding sequences, • Introns (not coding) • Exons (coding) • Promoters, and regulation sequences. 2. RNA polymerases are enzymes that will synthesize different kinds of RNA. 3. Other factors E. g. factor sigma: this stabilizes the polymerase at its specific site, to help polymerization to start. These other factors may be proteins or other kinds of molecules
Translation m. RNA UUUCUCAUUACUUAUUGUCGA now becomes Phe Leu Ile Thr Tyr Cys Arg Degenerate genetic code*…. what?
T C A G T TTT Phe (F) TTC Phe (F) TTA Leu (L) TTG Leu (L) TCT Ser (S) TCC Ser (S) TCA Ser (S) TCG Ser (S) TAT Tyr (Y) TAC Tyr (Y) TAA Ter TAG Ter TGT Cys (C) TGC Cys (C) TGA Ter TGG Trp (W) C CTT Leu (L) CTC Leu (L) CTA Leu (L) CTG Leu (L) CCT Pro (P) CCC Pro (P) CCA Pro (P) CCG Pro (P) CAT His (H) CAC His (H) CAA Gln (Q) CAG Gln (Q) CGT Arg (R) CGC Arg (R) CGA Arg (R) CGG Arg (R) A ATT Ile (I) ATC Ile (I) ATA Ile (I) ATG Met (M) ACT Thr (T) ACC Thr (T) ACA Thr (T) ACG Thr (T) AAT Asn (N) AAC Asn (N) AAA Lys (K) AAG Lys (K) AGT Ser (S) AGC Ser (S) AGA Arg (R) AGG Arg (R) G GTT Val (V) GTC Val (V) GTA Val (V) GTG Val (V) GCT Ala (A) GCC Ala (A) GCA Ala (A) GCG Ala (A) GAT Asp (D) GAC Asp (D) GAA Glu (E) GAG Glu (E) GGT Gly (G) GGC Gly (G) GGA Gly (G) GGG Gly (G)
m. RNA 1). Initiation Codon Anti – Condon Amino Acid t. RNA M H I S F P H 2). Elongation 3). Termination
RESEARCH……… We are interested in the evolution of the intron/exon structure of genes. Are the introns ancient structures, used to assemble the first genes four billion years ago? Or are they more recent acquisitions, used for exon shuffling in recently evolved proteins? Our work ranges from theoretical estimates for the size of the universe of exons to theoretical arguments that the introns are very old and that exons are related to folding subunits of proteins. We are studying the assembling of protein shapes from modular substructures.
Protein Encoding Exon Containing Genes • Based on current Gen. Bank release 133 • 128, 000 proteins – lots of info – Have positions of Introns boundaries in proteins – Have structural data from PDB – Have ability to visualize structure • • Can we correlate boundaries to structure? Are boundaries conserved b/t species? Were there ancient exons? Alternative Splicing?
- Chesley leslin
- Antisense strand
- Exons introns
- Lac vs trp operon
- Exons introns
- Proses produksi multimedia
- Axial and locomotor movement
- Production planning and inventory control
- Cased hole services
- Lean production and quality management
- Creating production possibilities schedules and curves
- Meaning of production plan