Whats living in your water DNABased Microbial Analysis

What’s living in your water? ™ DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E. Global Water Center, Milwaukee, WI trevor. ghylin@microbedetectives. com 414 -217 -7784 www. microbedetectives. com

Company Introduction • My Background o o Professional Engineer – CH 2 M Hill WEF Canham Graduate Studies Fellowship NIH Biotechnology Training Program Fellow Ph. D Candidate – Biotechnology • Founded in 2012 to improve access to DNA sequencing services o Global Freshwater Seed Accelerator Winner o Rising Star Award - Early Stage Symposium • Advisory Board - Current and former IWA presidents • Key Developers - Biomolecular Engineer, Bioinformaticist • Clients – CH 2 M Hill, Milwaukee Water, Consulting Firms

Current paradigm Problem: >99% of microbes can’t be cultured or identified under a microscope

Solution

DNA-Based Microbial Analysis Collect Environmental Sample (50 m. L sterile bottle) Sterilize, Preserve, Ship Add ethanol to 70% concentration to sterilize. Dilute with water to 25% for preservation and shipping (Shipping via Fedex: 5 days/$85 USD/51 GBP Concentrate Centrifuge or Filtration Extract DNA/Purify DNA Sequencing PCR Amplification/DNA Sequencing ATGCATT…. . . Assign Taxonomy (Proprietary) Nitrosomonas Bioinformatics/DNA Processing/Taxonomic Assignment Interpretation of Results (Proprietary) Healthy AOB population

Example DNA Data >594682 TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTACGTAG GCGGACCCG TCAGTGGTGAAAGTTTGCAGCTTAACTGTAAAATTGCCATTGAAACT ACGGGTCTT GAGTGTAAATGAGGTAGGCGGAATGTGTAGCGGTGAAATGCTTAG ATATAACACA GAACACCAATTGCGAAGGCAGCTTACTGGGATACAACTGACGCTGAGGCA CGAAAGCGTG GGGATCAAACAGG >594511 TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAACGCA GGCTGGAGAT TAAGCGTGCTGTGAAATGTACCGGCTCAACCGGTGACGTGCAGCGCGAAC TGGTTTCCTT GAGTACGACGTCAGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAG ATATCACGAA

Database of Wastewater Microbes (Proprietary)

Solution Cont’d

• Benefits Solution Cont’d o Wastewater Treatment • Solve treatment problems • Reduce energy and chemical consumption • Maximise digester energy production • Maximise effluent quality o Membrane Treatment • Solve Biofouling issues • Reduce chemical consumption • Reduce operational and maintenance labor • Increase membrane life o Drinking Water • Solve taste/odor issues • Solve coliform issues • Ensure quality and safety • Identify and fix distribution system issues

Case Studies

Membrane Biofouling

Membrane Biofouling Cont’d

Wastewater Treatment • Municipal SBR – Filamentous Bulking in Spring • SVI~300 • Poor settling, poor effluent quality • Potential to exceed permit TSS limit

Microscopy Results

Drinking Water Distribution System Case Study

• Project specific • Membrane Biofouling Costs o $2, 000 USD (1, 200 GBP) analysis (save >$10, 000 USD/6, 000 GBP in chemical/operational) • Wastewater Treatment o $600 USD (350 GBP) for 1 sample ($1000 USD/600 GBP) with microscopy) • Drinking Water o Provide distribution system insurance for pennies per resident • Business Model o Mail-in service business with additional consulting fee ($140/hr USD/85 GBP) o Return on investment can be extremely high

Status and Path Forward • Currently serving clients in drinking water and wastewater • Pilot studies o Wastewater Treatment • Year-long pilot; weekly or monthly samples o Drinking Water Distribution System • Single sampling event; collect samples from various locations in the distribution system • Multiple cities to generate more data o Membrane Biofouling

Status and Path Forward Cont’d • Plans o Pilot studies o Continue to serve clients and build our knowledge, refine our databases o Milwaukee distribution system project • Support Needed o Wastewater Treatment Demonstration o Membrane Biofouling Demonstration o Drinking Water Distribution System Demonstration

Summary and next steps • DNA analysis is economical o Superior to existing petri dish and microscopy methods • Need partners to do more extensive pilot testing work and demonstrate results o Reduced energy and chemical consumption o Improved drinking water quality o Improved membrane performance

Thank You What’s living in your water? Global Water Center, Milwaukee, WI trevor. ghylin@microbedetectives. com 414 -217 -7784 www. microbedetectives. com Linked. In: Trevor Ghylin