What Is Microarray n A new powerful technology

Replication Transcription DNA Translation RNA Protein Reverse transcription DNA m. RNA c. DNA ATATCGGCATCAGTCGATCATCGAT

What Is Microarray n Different Approaches How DNA sequences are laid down Length of

Affymetrix n Probe Array (Photolithography) n Synthesis of probe n Hybridization

Stanford Approach n n Use robot to spot glass slides Able to measure qualitatively

Life Cycle(cont. ) Cy 3 (green) Cy 5 (red)

Procedures n Preparation n Reaction(Droplet or Pin Spotting) n n n Target DNA (reference

Instruments n n Arrayer Scanner n Laser Confocal Microscope

Problems – by direct view Anti-probe Precipitate Locally high background Locally low signal Spot

Problems –related wit IP n Local problems n n Spot position variation Spot shape

Array Alignment Good Alignment Bad Alignment

Spot Finding n Grid System Determination n n Manual Semiautomatic Automatic Spot Segmentation n

Applications n Gene expression studies n n n Gene function for cell state change

Applications(Cont. ) n Drug Discovery n identify appropriate molecular targets for therapeutic intervention n

Slides: 32

Download presentation

What Is Microarray n A new powerful technology for biological exploration n n Parallel High-throughput Large-scale Genomic scale

Microarray

Replication Transcription DNA Translation RNA Protein Reverse transcription DNA m. RNA c. DNA ATATCGGCATCAGTCGATCATCGAT UAUAGCCGUAGUCAGCUAGUAGCUA ATATCGGCATCAGTCGATCATCGAT

What Is Microarray n Different Approaches How DNA sequences are laid down Length of DNA sequences Stanford/ Synteni Spotting Affymetrix Photolithography c. DNA(Complete Oligonucleotides sequences)

Affymetrix n Probe Array (Photolithography) n Synthesis of probe n Hybridization

Stanford Approach n n Use robot to spot glass slides Able to measure qualitatively relative expression levels of genes n n n Differential expression by use of simultaneous, two-color fluorescence hybridisation Cheaper with DIY ($60, 000) Also called home-made system

Life Cycle(cont. ) Cy 3 (green) Cy 5 (red)

Procedures n Preparation n Reaction(Droplet or Pin Spotting) n n n Target DNA (reference and test samples) Slides Hybridization Scanning Analysis n n n Image processing Data mining Modeling Arrayer Scanner Hardware Software

Instruments n n Arrayer Scanner n Laser Confocal Microscope

Arrayer

Scanner n Gen. Pix 4000

Problems – by direct view Anti-probe Precipitate Locally high background Locally low signal Spot overlap Comet-tails (donut hole)

Problems –related wit IP n Local problems n n Spot position variation Spot shape and size irregularity Spot Overlapping Global problems n n n High background Low signal White-noise/Speckle effect (Contamination)

Array Alignment Good Alignment Bad Alignment

Spot Finding n Grid System Determination n n Manual Semiautomatic Automatic Spot Segmentation n n Space-based Intensity-based Frequency-based Hybrid approach

Grid System Determination

Spot Segmentation

Spot Segmentation(cont. )

Applications n Gene expression studies n n n Gene function for cell state change in various conditions Disease Diagnosis Pathogen Analysis

Applications(Cont. ) n Drug Discovery n identify appropriate molecular targets for therapeutic intervention n monitor changes in gene expression in response to drug treatments n Trageted Drug Treatment

Example Images – E. Coli

Example Images – C. Elegan

Gene index 1. 75 Log(R/G) …. .

M experiments N gene …. .