Using Bioinformatics in Medicine Sickle Cell Anemia the
Using Bioinformatics in Medicine Sickle Cell Anemia & the Hemoglobin Gene AP Biology 2004 -2005
Sickle Cell Anemia § Most common genetic disease in US u u u AP Biology high incidence in African-Americans affects red blood cells potentially lethal 2004 -2005
Symptoms § Anemia u jaundice, fatigue, paleness, shortness of breath § Hypoxia (low oxygen) & capillary damage u u severe pain in organs & joints retinal damage (blindness) § Delayed growth u delayed puberty, stunted growth § Infections u u u more susceptible depressed immune death from bacterial infections § Stroke u u AP Biology blocked small blood vessels in brain primarily in children 2004 -2005
Sickle cell hemoglobin AP Biology mutant hemoglobin (Hb S) 2004 -2005
AP Biology 2004 -2005
Cell biology § Hb S molecules stick together form fibers u under low blood oxygen levels u distortion of cells from normal round to sickle shape u AP Biology 2004 -2005
Genetics § Sickle cell mutation u u u Hb S changes 6 th amino acid of hemoglobin chain normal glutamic acid valine § Recessive allele u heterozygote § Hb AS, normal, but carrier u Hb A Hb S 2 sickle cell carriers mate… Hb A Hb. AS homozygote recessive § Hb SS, sickle cell disease u § each child has 1/4 chance of having the disease Hb S Hb. AS AP Biology Hb. SS 2004 -2005
Prevalence in U. S. § Carriers ~2 million Americans carry sickle cell trait u 1 in 14 African-Americans u § Disease ~72, 000 Americans have disease u ~1 in every 700 African-American babies born in U. S. has sickle cell disease u AP Biology 2004 -2005
The Malaria Connection § Sickle cell disease is surprisingly common for a potentially lethal genetic disease § Heterozygote advantage u AP Biology heterozygotes are tolerant of malaria infection & do not suffer symptoms of sickle cell disease 2004 -2005
Malaria AP Biology 2004 -2005
Prevalence of Malaria Prevalence of Sickle Cell Anemia AP Biology cell movie~ ~sickle 2004 -2005
Public health § Many carriers of this mutant allele are not aware that they have it u at risk of having children with the disease § DNA test for sickle cell allele would benefit public health u u AP Biology genetic counseling pre-natal testing 2004 -2005
Your Assignment § Develop a simple inexpensive DNA test for sickle cell allele u develop DNA probe § test for presence of sickle cell mutation u use bioinformatics tools § online databases of DNA sequences w UCSC Genome Browser § probe design tool w Primer 3 AP Biology 2004 -2005
DNA review § DNA double helix A–T, C–G u base pair bonds can be broken by heating to 100°C u § separate strands § denature, or melt AP Biology 2004 -2005
DNA probes § Probe u u short, single stranded DNA molecule mix with denatured DNA § DNA Hybridization u probe bonds to complementary DNA sequence § Label u probe is labeled for easy detection labeled probe genomic DNA AP Biology 3’ G A T C A G T A G C T A G T C A T C 2004 -2005 5’
Designing Probes § Allele specific probes require matched sequences u can detect single base differences in alleles u single mis-matched base near middle of probe greatly reduces hybridization efficiency u genomic DNA A G T CG C T G A labeled probe X C T A G T C AP Biology 3’ 2004 -2005 5’
Dot blot § Genomic DNA denature DNA u bind DNA from cells on filter paper u § DNA hybridization wash probe over filter paper u if complementary sequence present, probe binds to genomic DNA u expose on X-ray film u § dark spots show bound probe AP Biology 2004 -2005
Get hemoglobin sequence § UCSC Genome Browser human genome database u http: //genome. ucsc. edu/ u § § § AP Biology UCSC Genome Browser home page click on link to Genome Browser in genome pulldown menu, choose “Human” for position text box, type “HBB” (hemoglobin ) hit “submit” 2004 -2005
Genome Browser Results § Listing of genes & sequences in database u AP Biology Click on “Ref. Seq” gene for HBB (NM_000518) 2004 -2005
Chromosome view § Position of HBB in genome u AP Biology at base 5. 2 million on chromosome 11 2004 -2005
Change view of chromosome § Move & zoom tools u AP Biology zoom out ~30 x to see more of chromosome 11 2004 -2005
More Hb genes § Cluster of hemoglobin genes on chromosome 11 HBD, HBG 1, HBG 2 & HBE 1 u what are these genes? u AP Biology 2004 -2005
Get the DNA sequence § Click on the HBB Ref. Seq gene u AP Biology HBB Ref. Seq summary page 2004 -2005
HBB Ref. Seq gene summary page § Click on “Genomic Sequence from assembly” AP Biology 2004 -2005
Formatting the sequence § Sequence Formatting Options “exons in upper case, everything else in lower case” u hit “submit” u § Genomic DNA u lower case = introns § spliced out of m. RNA before translation u upper case = exons § translated into polypeptide chain AP Biology 2004 -2005
HBB DNA sequence >hg 16_ref. Gene_NM_000518 range=chr 11: 5211005 -5212610 5'pad=0 3'pad=0 rev. Comp=TRUE ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGgttggtat caaggttacaagacaggtttaaggagaccaatagaaactgggcatgtgga gacagagaagactcttgggtttctgataggcactgactctgcctat tggtctattttcccacccttag. GCTGCTGGTGGTCTACCCTTGGACCCAG AGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGG CAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTG ATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGT GAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGgtgag tctatgggacgcttgatgttttccccttcttttctatggttaagtt catgtcataggaaggggataagtaacagggtacagtttagaatgggaaac agacgaatgattgcatcagtgtggaagtctcaggatcgttttagtttctt u ttatttgctgttcataacaattgttttcttttgtttaattcttgctttct ttttcttctccgcaatttttactattatacttaatgccttaacatt gtgtataacaaaaggaaatatctctgagatacattaagtaacttaaaaaa aaactttacacagtctgcctagtacattactatttggaatatatgtgtgc ttatttgcatattcataatctccctactttattttcttttatttttaatt gatacataatcattatacatatttatgggttaaagtgtaatgttttaata tgtgtacacatattgaccaaatcagggtaattttgcatttgtaattttaa aaaatgctttcttcttttaatatacttttttgtttatcttatttctaata ctttccctaatctctttcagggcaataatgatacaatgtatcatgc ctctttgcaccattctaaagaataacagtgataatttctgggttaaggca Biology 2004 -2005 atagcaatatctctgcatataaatatttctgcatataaattgtaactgat § first 50 bases are untranslated “leader” sequence § actual protein coding sequence starts at base 51 starting with letters ATG AP
Get the mutant sequence § Sickle cell mutation u u u single base mutation 6 th amino acid: glutamic acid valine need DNA sequence to design probe § SNPs u u AP Biology single nucleotide polymorphisms “variations and repeats” section: pack 2004 -2005
SNPs of HBB gene § several SNPs of HBB gene need mutation in exon u near beginning of HBB protein u rs 334 = Hb S mutation u AP Biology 2004 -2005
rs 334 Hb S sickle cell mutation § “Sequence in Assembly” = normal sequence § “Alternate Sequence” = sickle cell sequence AP Biology 2004 -2005
Align Hb A & Hb S sequences § Line up sequences Normal: catggtgcacctgactcctg. Aggagaagtctgccgttactg HBB: ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG Mutant: catggtgcacctgactcctg. Tggagaagtctgccgttactg u AP Biology sequence fragment is enough to design DNA probes for normal & mutant sequences 2004 -2005
Designing the probe § Primer 3 u free on Web from MIT http: //frodo. wi. mit. edu/cgi-bin/primer 3_www. cgi u powerful tool for primer design § paste in sequence fragment AP Biology 2004 -2005
Allele specific probes § Need 2 probes normal allele probe u sickle cell allele probe u choose hybridization probes u § Customize probes 12 -16 bases u 40°-60°C u longer probes are stable higher temperatures APat Biology 2004 -2005
Your probes… § Ready to order! § Place an order at your local DNA lab! AP Biology 2004 -2005
Extra credit Advanced Assignments AP Biology 2004 -2005
Advanced Assignment #1 § Use the Web to research other “allele specific” genotyping methods ligase chain reaction u primer extension u Taq. Man u § Design probes for one of these alternate technologies AP Biology 2004 -2005
Advanced Assignment #2 § PCR & Restriction Digest u pre-natal testing § for small samples it is necessary to use PCR to amplify the amount of genomic DNA before testing § once you have a PCR-amplified DNA fragment of a gene, a restriction enzyme may be able to distinguish between alleles u design PCR primers & find restriction enzyme that will locate sickle cell allele § design with Primer 3 AP Biology 2004 -2005
Restriction enzymes § NEBcutter http: //tools. neb. com/NEBcutter 2 u New England Bio. Labs u screens DNA sequence against all restriction enzymes u § Webcutter similar program u http: //www. firstmarket. com/cutter/cut 2. html u AP Biology 2004 -2005
NEBcutter AP Biology 2004 -2005
Advanced Assignment #3 § Population genetics u determine if sickle cell allele is in Hardy. Weinberg equilibrium in the U. S. African -American population § ~2 million Americans carry sickle cell trait § 1 in 14 African-Americans is a carrier § ~1 in every 700 African-American babies born in U. S. has sickle cell disease AP Biology 2004 -2005
- Slides: 39