USEC Workshop on Marine Genomics Washington DC fall

US-EC Workshop on Marine Genomics, Washington DC fall 2010 Training the next generation of Biologists Roderic Guigó, roderic. guigo@crg. cat Center for Genomic Regulation, Barcelona

http: //bioinformatica. upf. edu/

disclaimers • University Pompeu Fabra – Ranks 155 in the world (Times Higher Education) – Only two spanish universitites among the top 200. (Univeristy of Barcelona, 142) • Disparity between the American and European undergraduate systems • Disparity even within European countries – Bologna process

Bologna process • The purpose of the Bologna Process is to create the European Higher Education Area by making academic degree standards and quality assurance standards more comparable and compatible throughout Europe – 1 st cycle: typically 180− 240 ECTS credits, usually awarding a Bachelor's degree. 3 years – 2 nd cycle: typically 90− 120 ECTS credits (a minimum of 60 on 2 nd-cycle level). Usually awarding a Master's degree. 2 years – 3 rd cycle: Doctoral degree. No ECTS range given. 3 years, aprox.

Why “next generation biologists” should be trained differently than biologists of previous generations?

Why “next generation biologists” should be trained differently than biologists of previous generations? • The impact of technology – in the way we do Biology

Technology is not new to Biology In 1676 his credibility was questioned when he sent the Royal Society a copy of his first observations of microscopic single celled organisms. Heretofore, the existence of single celled organisms was entirely unknown … The Royal Society arranged to send an English vicar, as well as a team of respected jurists and doctors to Delft, Holland to determine whether it was in fact Van Leeuwenhoek's ability to observe and reason clearly (wikipedia)

Two moments in the second half of the past century 1. Sequencing (Sanger et al) ACTCAGCCCCAGCGGAGGTGAAGGACGTCCTTCCCCAGGAGCCGGTGAGAAGCGCAGTCGGGGGCACGG GGATGAGCTCAGGGGCCTCTAGAAAGATGTAGCTGGGACCTCGGGAAGCCCTGGCCTCCAGGTAGTCTCA GGAGAGCTACTCAGGGTCGGGCTTGGGGAGAGGAGGAGCGGGGGTGAGGCCAGCAGCAGGGGACTGGA CCTGGGAAGGGCTGGGCAGCAGAGACGACCCGCTAGAAGGTGGGGAGAGCATGTGGACT AGGAGCTAAGCCACAGCAGGACCCCCACGAGTTGTCACTGTCATTTATCGAGCACCTACTGGGTGTCCCCA GTGTCCTCAGATCTCCATAACTGGGAAGCCAGGGGCAGCGACACGGTAGCCGTCGATTGGAGAACT TTAAAATGAGGACTGAATTAGCTCATAAATGGAAAACGGCGCTTAAATGTGAGGTTAGAGCTTAGAATGTG AAGGGAGAATGAGGAATGCGAGACTGGGACTGAGATGGAACCGGCGGTGGGGAGGGGGTGTG GAATTTGAACCCCGGGAGAGAAAGATGGAATTTTGGCTATGGAGGCCGACCTGGGGAAATAAGA GAAGACCAGGAGTTAAATAGGGAATGGGTTGGGGGCGGCTTGGTAACTGTTTGTGCTGGGATTAGG CTGTTGCAGATAATGGAGCAAGGCTTGGAAGGCTAACCTGGGGCCGGGTTGGGGTCGGGCTGGG GGCGGGAGGAGTCCTCACTGGCGGTTGACAGTTTCTCCTTCCCCAGACTGGCCAATCACAGGA AGATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGTATGGGGCTTGCTCGGTTTT CCCCGCTTCTCCCCCTCTCATCCTCAACCTCCTGGCCCCATTCAAGCACACCCTGGGCCCCCTCTTC TTCTGCTGGTCTGTCCCCTGAGGGGAAAGCCCAGGTCTGAGGCTTCTATGCTGCTTTCTGGCTCAGAACAG CGATTTGACGCTCTGTGAGCCTCGGTTCCTCCCCCGCTTTTTTCAGCCAGAGTCTCACTCTGTCGCCC AGGCTGGAGTGCAGTGGCGCAATCTCAGCTCACTGCAAGCTCCGCCTCCCGGGTTCACGCTATTCTCCCGC CTCAGCCTCCCGAGTAGCTGGGACTACAGGCGCCACCATGCCCGGCTAATTTTTTGTACTTTGAGTA GGGAAGGGGTTTCACTGTATTATCCAGGATGGTCTCTATCTCCTGACCTCGTGATCTGCCCGCCTGGCCTCC CAAAGTGCTGGAATTACAGGCGTGAGCCTCCGCGCCCGGCCTCCCCATCCTTAATATAGGAGTTAGAAGTT TTTGTTTGTTTTGTTTTGTTTTGAGATGAAGTCCCTCTGTCGCCCAGGCTGGAGTGCAG

Two moments in the second half of the past century 2. mutliplexing, automating, … – Surveying many things at once – Surveying whole systems

From analytic to syntetic Biology is transitioning (at least partially) from an “analytic” science: the real world is disected in its elemental components in order to be comprehended to “syntetic” science: the challenge is the integration of globlal information on the living cell/individual/population/(eco)sytem.

From data acquisition to data analysis Biology, a science in which the effort has traditionally been directed towards data aquisition has become in a very short time a discipline in which the data is obtained with almost no human intervention, and the effort is turning towards data analysis.

DNA microarrays 30 December 2021 13

In summary • Intrinsec symbolic/computational nature of biological (genomic) data • Emphasis in synthesis (rather/in addition to analysis) • Exponential data production – Separated from human intervention

Bioinformatics, Genomics, Systems Biology in Medline

Bioinformatics Google search: X-informatics (11 juny, 2007) bioinformatics chemoinformatics astroinformatics neuroinformatics socioinformatics geoinformatics meteoinformatics econoinformatics ecoinformatics 14, 100, 000 226, 000 195 364, 000 610 506, 000 48 441 160, 000

Engineering and biology: increasingly interconnected • Improved technologies to survey Biological Systems – NGS and the like [technological fluency] • Engineering of Biological Systems – Medicine – New and modified biological systems • Using Biology to build non-biological systems – DNA computing

Biology has changed and it is changing • Quantitative thinking • Ability to attack unanticipated problems

Biology requires quantitative thinking • • Statistics Mathematics Computer Science … and programming skills (unix) • The ability to interrogate data, and to models systems

Biology is not anymore softer than other hard sciences

• We do not know the problems that our future biologists will have to address, and what competences will be important for them. But – Competences required are likely to be very heterogeneous

Training the next generation of Biologists Scientists

What Is the Integrated Science Curriculum? The curriculum covers the core material of introductory physics, chemistry, biology (genetics and biochemistry), and computer science, all in an integrated manner. The central role of mathematics as a universal language of science is emphasized throughout. In every area of science, students learn in part through quantitative problem solving; to this end computational methods are taught and integrated into the entire program. Collaborative problem solving is stressed over memorization and regurgitation of facts. Close contact between students and faculty is a major feature of the new curriculum; class sizes are kept small.

Identification of selenoproteins in the genomes of protists

Sel. U

Changes in sociology of science

Internet and Information Technology is changing sociology of Science • Small individual projects transitioning to large -scale multi-site projects – Distributed expertise • Diffuse, geographically disperse, dynamically evolving group of colleagues • Virtual communication (over the phone, internet) increasingly important – ENCODE. I have a minimum of 4 conference calls a week (including groups from California, East Cost, Europe, Singapore, Japan)

Changes in the way we communicate with other (human) colleagues • Collaborative problem solving over the Internet – Students in different places (ideally with complementary expertise) working together to solve the same problem

Learning to communicate with non-human intelligent agents • Data grows super-exponentially • Computers grows exponentially • People grow linearly (at the best) => Increasingly large fraction of scientific activity left to the machines.

Training in biology to nonbiologists • Law • International and National Policy (bioterrorism, climate change, biodiversity, …) • Forensic • History, Arqueology • Arquitecture, …

Summary • Quantitative thinking is essential – But do not forget Natural History • Programming as important and lab skills • Ultra specialization is bad – We can not anticipate the relevant problems – Follow Integrative Science approaches • Collaborative work will take precedence over individual work – Teach communication skills over virtual communities of colleagues – Communication with non-human intelligent agents • Emergence of Biological technologies