Translation What is the Genetic Code and how

Translation • What is the Genetic Code, and how is it read? – Our 1 st step • Understanding Vocabulary – Define & Draw these… – Polypeptide -- Genetic Code – Codon --Translation – Anticodon -- Gene Expression – Amino Acid -- Heredity

Protein Synthesis m. RNA to Protein Translation

Key Question • As a group, try to figure out this key question: – What is meant by “The Genetic Code, ” and how is it “read”?

Translation • What is Translation = • What is The Genetic Code – Language of 4 letters in 3 -letter words. • Called Codons

Translation • How many codons are possible? – 64

Translation • What do codons code for? – Code for Amino Acids

Translation • As a group, complete the following: – Be ready to talk about this and possibly draw a diagram of your answer: • What is the Process of Translation? • Where does Translation occur? • Who are the “major players” of translation and what are their roles?

Translation • Where does Translation always start? – Start Codon • AUG is always the Start Codon • Corresponds with Met (Methionine) • Where does Translation end? – Stop Codons • UAA, UAG, UGG • Why are these stop codons? – Don’t correspond with any Amino Acid

Translation Review so far: • Where does Translation Occur? – Ribosome • What does the Ribosome do? – Uses the sequence of m. RNA codons to assemble Amino Acids into Polypeptide Chains (Proteins) • How do Ribosomes do this? – Lets look at this…

Steps of Translation • Depending on the textbook, there are 5 -6 steps of translation: – What are the steps of translation? • Draw a picture representing each step…

Steps of Translation Lettuce Review… Step 1 • m. RNA attaches to Ribosome • Ribosome reads Start Codon

Steps of Translation Step 2 • Ribosome brings in appropriate t. RNA – How does this happen?

Steps of Translation Step 2 cont. • t. RNA – Shaped specifically • Anticodon – – m. RNA attachment site – Complimentary sequence to m. RNA codon • Amino Acid site

Steps of Translation Step 3 • Ribosome completes it’s structure • Ribosome has 3 Important Sites…

Steps of Translation • Ribosome Structure – A site • Active Site – – Where “reading” occurs – P Site • Peptide Site – Where amino acids are joined together – E Site • Exit Site – Where “empty” t. RNA’s leave to get more amino acids

Steps of Translation Step 4 • Ribosome Moves & reads next codon • Ribosome brings in Appropriate AA. • Called = Elongation

Steps of Translation Step 5 • Peptide bond is formed • Ribosome reads next codon • Releases 1 st t. RNA

Steps of Translation Step 6 • Step 4 & 5 are repeated until Termination

Heredity • Gene Expression – The Central Dogma of molecular biology is: • Information is transferred from DNA RNA Protein – Proteins are the “Workers” of organisms • Produce pigment • enzymes that control reproduction – Proteins are: • Microscopic tools, each specifically designed to build or operate a component of a living cell • Important players in producing an organism’s traits

How Does a Cell Interpret Codons? Write the following gene on your paper. TACGACAAGTCCACAATCCAT 1. From Left to Right, write the sequence of the m. RNA molecule transcribed from this gene. 2. Translate the m. RNA into it’s t. RNA sequences. 3. Using the table of anti-codons, write the amino acid sequence. 4. Repeat step 3, reading the codons from right to left. 5. Analyze & Conclude: 1. Why did steps 3 & 4 produce different polypeptides? 2. Do cells usually decode m. RNA’s in one direction only or in either direction?

t. RNA anti-codons

Translation Review Complete on a Separate Piece of Paper 1. How does a cell interpret the genetic code? 2. What are codons and anticodons? 3. Using the table of anti-codons, identify the amino acids specified by the codons UGG, AAG, and UGC 4. What happens during translation? 5. How is protein synthesis different then DNA replication? 6. Why is the genetic code considered universal? 7. What does the term gene expression mean? 8. In what way does controlling the proteins in an organism control the organisms characteristics? Due Friday 5/10 Answers will be posted on the PEP server after the due date.