Translation The nd 2 step in Protein Synthesis

Translation The nd 2 step in Protein Synthesis

Translation Vocabulary 18)Anticodon 19)‘AUG’ 20)Codon 21)Polypeptide 22)‘Stop’ Codon 23)Translation

IV. Translation A. Proteins are long chains of amino acids. B. Codon: 3 consecutive nucleotides that “code” for a specific amino acid. • What is the universal “start” codon: • AUG • What are three “stop” codons? • UGA, UAG

The Genetic Code (m. RNA to Protein) Translating an m. RNA codon: Start from the center and move outward.

The Genetic Code Start from the left side, the bottom, then right side.

C. Use the genetic code below to translate the following m. RNA sequences (into amino acids) 1. m. RNA: AUGUAUCGGGCAUUUUAA 2. m. RNA: UCCAUGGAAGUGAUUCCAUAA 3. m. RNA: CCAUGUGUCCCCAAUGAAAA

C. Use the genetic code below to translate the following m. RNA sequences: 1. m. RNA: AUGUAUCGGGCAUUUUAA Methionine (START), Tyrosine, Arginine, Alanine, Phenylalanine, STOP. 2. m. RNA: UCCAUGGAAGUGAUUCCAUAA Serine, Methionine, Glutamic Acid, Valine, Isoleucine, Proline, STOP 3. m. RNA: CCAUGUGUCCCCAAUGAAAA Methionine, Cysteine, Proline, Glutamine, STOP, Lysine

D. Translation: The decoding of RNA into a polypeptide chain (protein)

E. The Central Dogma of Biology is: DNA RNA protein Where does the first step take place? Nucleus Where does the second step take place? Cytoplasm

F. What is the job of t. RNA during translation? Bringing amino acids to ribosomes, match them with the correct base on m. RNA. What is an anticodon? The three bases on t. RNA that match with m. RNA codons. G. What is the role of the ribosome during translation? It is the site of protein assembly

The 4 steps of Translation

H. 1) m. RNA is transcribed in the nucleus then travels to the cytoplasm

2) Ribosome grabs m. RNA. t. RNA brings amino acids to the ribosome

3) t. RNA matches with complimentary m. RNA. Ribosome makes peptide bond between amino acids, and breaks the bond between t. RNA and amino acid.

4) Peptide chain continues to grow until ribosome reaches a stop codon Protein is complete.

Protein structure/folding • Primary • Amino acids holding hands • Secondary • Alpha helix • Beta pleated sheets • Tertiary • Quaternary