Transcription Translation Protein Synthesis Protein Synthesis n n

Protein Synthesis n n Protein synthesis is the process in which a cell makes

Protein Synthesis n n How do the many different messages within the DNA molecule

Ribonucleic Acids (RNA) n n The job of RNA (ribonucleic acid) is to carry

Ribonucleic Acids (RNA) n RNA is almost exactly like DNA, except: n n n

Protein Synthesis n Occurs in TWO steps: Transcription – the genetic information from a

The Central Dogma n This order of events is called the central dogma of

Step One: Transcription 1. 2. 3. DNA unzips: enzymes split apart base pairs and

Step One: Transcription n Try it! What RNA strand will be made from the

Step 1½: RNA Editing n n An m. RNA molecule has to be “edited”

Step 1½: RNA Editing DNA transcription pre-RNA (in nucleus) exon 1 interon RNA editing

Step Two: Translation n n Now that our m. RNA molecule has been made,

Step Two: Translation n Problem: n n There are 20 different amino acids. There

Step Two: Translation 1. 2. So how do you exactly go about determining what

Step Two: Translation Since each 3 -letter combination “codes” for an amino acid, you

Step Two: Translation 2. Since each 3 -letter combination “codes” for an amino acid,

RECAP: 1. 2. 3. DNA is transcribed into m. RNA in the nucleus. The

Slides: 24

Download presentation

Transcription, Translation & Protein Synthesis

Protein Synthesis n n Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: n n DNA is only found in the nucleus Proteins are only made outside the nucleus – in the cytoplasm.

Protein Synthesis n n How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA – RNA – is used to carry these messages.

Ribonucleic Acids (RNA) n n The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). There are three types of RNA: 1. 2. 3. m. RNA – carries a message from the DNA to the ribosome t. RNA – transports amino acids to the m. RNA to make a protein r. RNA – make up ribosomes, which make protein.

Ribonucleic Acids (RNA) n RNA is almost exactly like DNA, except: n n n Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) Contains uracil instead of thymine. RNA is single-stranded, not doublestranded

Ribonucleic Acids (RNA)

Protein Synthesis n Occurs in TWO steps: Transcription – the genetic information from a strand of DNA is copied into a strand of m. RNA 2. Translation – the m. RNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the m. RNA. 1.

The Central Dogma n This order of events is called the central dogma of molecular biology: DNA RNA P R O T E I N

Step One: Transcription 1. 2. 3. DNA unzips: enzymes split apart base pairs and unwind the DNA double helix. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands. What will be different? ? New backbone formed: The sugarphosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

Step One: Transcription n Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT

Step One: Transcription n Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA

Step 1½: RNA Editing n n An m. RNA molecule has to be “edited” in order to be useful. There’s a lot of unnecessary information that needs to be removed. An m. RNA sequence that does NOT code for protein is called an interon A sequence that is useful in making a protein is called an exon

Step 1½: RNA Editing DNA transcription pre-RNA (in nucleus) exon 1 interon RNA editing exon 2 interon RNA (in cytoplasm) exon 1 exon 2 exon 3

Step Two: Translation n n Now that our m. RNA molecule has been made, it’s time for its message to be made into a protein sequence. How does the m. RNA sequence translate into an amino acid sequence?

Step Two: Translation n Problem: n n There are 20 different amino acids. There are 4 RNA bases. A T C G phe ile leu val met pro ser ala thr his tyr asn gln asp lys cys glu arg trp gly

Step Two: Translation 1. 2. So how do you exactly go about determining what protein your cells are going to make? FIRST, Divide the m. RNA sequence into codons. As you just saw and heard, codons are three-base sections of m. RNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Step Two: Translation Since each 3 -letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: 2. AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ?

The Genetic Code

Step Two: Translation 2. Since each 3 -letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met ?

The Genetic Code

Step Two: Translation 2. Since each 3 -letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met arg thr asp arg ser asp ? ? ?

The Genetic Code

RECAP: 1. 2. 3. DNA is transcribed into m. RNA in the nucleus. The m. RNA leaves the nucleus and enters the cytoplasm. The protein is translated from the m. RNA sequence using t. RNA and amino acids.