TPSe TPSf Ranunculales TPSc TPSa 2 TPSg 0

  • Slides: 8
Download presentation
TPS-e TPS-f Ranunculales TPS-c TPS-a 2 TPS-g 0. 1 TPS-a 1 TPS-b Supplemental Figure

TPS-e TPS-f Ranunculales TPS-c TPS-a 2 TPS-g 0. 1 TPS-a 1 TPS-b Supplemental Figure S 1. Dendrogram analysis of angiosperm terpene synthase genes. TBLASTN analysis was performed to extract TPS genes from six monocotyledonous species (Zea mays, Sorghum bicolor, Setaria italica, Panicum virgatum, Oryza sativa, Brachypodium distachyon) and 27 dicotyledonous species (Aquilegia coerulea, Arabidopsis lyrata, A. thaliana, Brassica rapa, Capsella rubella, Carica papaya, Citrus clementina, Citrus x sinensis, Cucumis sativus, Eucalyptus grandis, Eutrema salsugineum, Fragaria vesca, Glycine max, Gossypium raimondii, Linum usitatissimum, Malus x domestica, Manihot esculenta, Medicago truncatula, Mimulus guttatus, Phaseolus vulgaris, Populus trichocarpa, Prunus persica, Ricinus communis, Solanum lycopersicum, S. tuberosum, Theobroma cacao, Vitis vinifera) available in the plant genome database Phytozome 9. 1 (https: //phytozome. jgi. doe. gov/pz/portal. html) and from diverse species of Arecales, Asparagales, Liliales, Zingiberales, Laurales, and Magnoliales available in the NCBI database (https: //www. ncbi. nlm. nih. gov/). The tree was inferred by using the Maximum Likelihood method based on the General Time Reversible model (Rates among sites, G+I). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. TPS subfamilies are listed according to Chen et al. (2011). The split between TPS-a 1 (dicots) and TPS-a 2 (monocots) had been previously recognized.

Zm. TPS 20 -Del 1 8 6 4 2 2 15 3 45 16

Zm. TPS 20 -Del 1 8 6 4 2 2 15 3 45 16 17 6 18 19 7 7. 5 6. 0 4. 5 3. 0 1 1. 5 15 1 50 2 3 16 4 6 5 17 18 Retention time (min) 19 Relative abundance (TIC x 10, 000) injector temperature 150°C Relative abundance (TIC x 100, 000) 10 injector temperature 230°C clade I ancestor 2 40 30 3 20 8 10 14 15 16 17 18 20 2 16 12 8 8 3 1 4 14 15 16 7 17 18 Retention time (min) Supplemental Figure S 2. GC-MS analysis of Zm. TPS 20 -Del and clade I ancestor products demonstrating that β-elemene is a thermal rearrangement product of germacrene A. Genes were heterologously expressed in Escherichia coli and partially purified proteins were incubated with (E, E)-FPP. TPS reaction products were collected from the headspace of the enzyme assays using a solid phase microextraction (SPME) fiber and analyzed by GC-MS with different injection temperatures to visualize heat-induced rearrangements. Total ion current chromatograms are shown. 1, β-elemene; 2, (E)-β-caryophyllene; 3, α-humulene; 4, unidentified sesquiterpene 1; 5, unidentified sesquiterpene 2; 6, unidentified sesquiterpene alcohol 1; 7, germacrene A; 8, germacrene D. Please note: Since the different enzymes were not measured on the same day and the GC column was shortened/exchanged in between measurements, the retention times in the left chromatograms slightly differ from those in the right chromatograms.

A ### chlorop v 1. 1 prediction results ######### Number of query sequences: 1

A ### chlorop v 1. 1 prediction results ######### Number of query sequences: 1 Name Length Score c. TP CSc. TPscore length --------------------------------------Sequence 608 0. 538 Y 6. 430 22 -------------------------------------- B ### targetp v 1. 1 prediction results ############## Number of query sequences: 1 Cleavage site predictions not included. Using PLANT networks. Name Len c. TP m. TP SP other Loc RC ----------------------------------------------Sequence 608 0. 861 0. 301 0. 067 C 3 ----------------------------------------------cutoff 0. 000 C ### Predotar v. 1. 04 using plastid prediction networks ############# Sequence Mitochondrial Plastid ER Elsewhere Prediction ---------------------------------------------------------0, 12 0, 45 0, 01 0, 48 possibly plastid ---------------------------------------------------------- Supplemental Figure S 3. Signal peptide prediction for Zm. TPS 15 -B 73. Signal peptide prediction was done using the web-based prediction programs chlorop v 1. 1 (http: //www. cbs. dtu. dk/services/Chloro. P/) (A), targetp v 1. 1 (http: //www. cbs. dtu. dk/services/Target. P/) (B), and Predotar v 1. 04 (https: //urgi. versailles. inra. fr/predotar/) (C). c. TP, chloroplast transit peptide. Y, yes; c, chloroplast.

clade IV LOC Os 03 g 24680. 1 LOC Os 03 g 24690. 1

clade IV LOC Os 03 g 24680. 1 LOC Os 03 g 24690. 1 LOC Os 03 g 24640. 1 Sobic. 001 G 363400. 1 Pavir. Ia 03329. 1 Pavir. Ib 01731. 1 Bradi 3 g 35027. 1 Si 009877 m Sobic. 006 G 010100. 1 GRMZM 2 G 010356. T 01 GRMZM 2 G 319445. T 01 Sobic. 005 G 130100. 1 Sobic. 007 G 187100. 1 Si 026185 m Sobic. 003 G 368600. 1 Species Grass clade Oryza sativa Sorghum bicolor Panicum virgatum Brachypodium distachyon Setaria italica Sorghum bicolor Zea mays Sorghum bicolor Setaria italica Sorghum bicolor BEP BEP PACMAD PACMAD PACMAD Species Grass clade Oryza sativa Oryza sativa Brachypodium distachyon Sorghum bicolor Zea mays Sorghum bicolor Panicum virgatum Brachypodium distachyon Setaria italica Phyllostachys edulis Oryza sativa Phyllostachys edulis Panicum virgatum Setaria italica Zea mays Panicum virgatum Sorghum bicolor Zea mays BEP BEP BEP PACMAD PACMAD BEP BEP BEP PACMAD PACMAD 0. 050 clade V LOC Os 04 g 27190. 1 LOC Os 04 g 27340. 1 LOC Os 04 g 27400. 1 LOC Os 04 g 27540. 1 LOC Os 04 g 27790. 1 LOC Os 04 g 27720. 1 LOC Os 04 g 27070. 1 LOC Os 04 g 26960. 1 Bradi 4 g 04965. 1 Bradi 5 g 01766. 1 Bradi 5 g 01797. 2 Bradi 5 g 01823. 1 Sobic. 006 G 247500. 1 AC 205502. 4 FGT 004 Sobic. 001 G 373300. 1 Pavir. Ia 03689. 1 Pavir. Ib 01646. 1 Bambus. PH 01001404 G 0410 Sobic. 001 G 173000. 1 Bambus. PH 01000457 G 0380 LOC Os 07 g 11790. 1 LOC Os 01 g 42610. 1 LOC Os 03 g 22634. 1 Bambus. PH 01001404 G 0350 Pavir. Ib 01662. 1 Si 035043 m GRMZM 2 G 038153 Pavir. Fb 01576. 1 Sobic. 007 G 133900. 1 AC 217050. 4 FGT 007 0. 050 Supplemental Figure S 4. Subtrees (clade IV and clade V) extracted from the dendrogram shown in Supplemental Figure S 1. Species names and the respective grass clades to which they belong are given.

100 Si 015370 m Setaria italica Si. TPS 7 Setaria italica Sb. TPS 5

100 Si 015370 m Setaria italica Si. TPS 7 Setaria italica Sb. TPS 5 Sorghum bicolor 98 Si. TPS 1 Setaria italica 100 93 Si. TPS 18 Setaria italica Zm. TPS 20 -Del Zea mays 100 Zm. TPS 22 -Del Zea mays 99 100 Si. TPS 11 Setaria italica 91 Pv. TPS 1 Panicum virgatum Si. TPS 3 Setaria italica 95 100 Si. TPS 27 Setaria italica Pv. TPS 85 Panicum virgatum 99 Pv. TPS 11 Panicum virgatum 100 Pv. TPS 14 Panicum virgatum 100 80 96 Pv. TPS 19 Panicum virgatum BAK 02818 Hordeum vulgare 100 EMT 29977 Aegilops tauschii Zm. TPS 23 Del 1 Zea mays 100 clade I ancestor Sb. TPS 4 Sorghum bicolor 100 98 BAJ 92610 Hordeum vulgare BAJ 98359 Hordeum vulgare 100 BAJ 97672 Hordeum vulgare 100 EMS 50673 Triticum aestivum Bradi 3 g 14710 Brachypodium distachyon 100 On. TPS 1 Oryza nivara Oglu. TPS 1 Oryza grandiglumis 100 93 66 74 52 Ob. TPS 1 Oryza barthii Or. TPS 1 Oryza rufipogon Og. TPS 1 Oryza glaberrima Os. TPS 1 Oryza sativa Oo. TPS 1 Oryza officinalis Os 08 g 07100 Oryza sativa 0. 1 Supplemental Figure S 5. Dendrogram analysis of Poaceae TPS-a genes from clade I. The tree was inferred by using the Maximum Likelihood method based on the Kimura 2 -parameter model (Rates among sites, G+I). Bootstrap values (n = 1000 replicates) are shown next to each node. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Rice Os 08 g 07100 was included as outgroup. Characterized terpene synthases are shown in red. TPS enzymes characterized in this study are shown in blue.

56 Zm. TPS 10 -mex Zea mexicana 33 Zm. TPS 10 -parv Zea parviglumis

56 Zm. TPS 10 -mex Zea mexicana 33 Zm. TPS 10 -parv Zea parviglumis 53 Zm. TPS 10 -hue Zea huehuetenangensis Zm. TPS 10 -B 73 Zea mays 100 Zm. TPS 10 -lux Zea luxurians 100 73 46 Zm. TPS 10 -per Zea perennis 70 Zm. TPS 10 -dip Zea diploperennis Sb. TPS 3 Sorghum bicolor 100 Sb. TPS 2 Sorghum bicolor Si. TPS 15 Setaria italica 99 100 Pv. TPS 109 Panicum virgatum Sb. TPS 1 Sorghum bicolor 72 Os 120 Oryza sativa Oba 080 Oryza barthii 100 On 080 Oryza nivara 99 Or 100 Os 100 Oryza sativa 100 52 clade II ancestor Oryza rufipogon Og 100 Oryza glaberrima Pe. TPS 10 like Phyllostachys edulis 100 Si. TPS 12 -2 Setaria italica Pv. TPS 20 Panicum virgatum 94 Zm. TPS 6 -B 73 Zea mays 100 Zm. TPS 11 -B 73 71 Zea mays Bradi 3 g 15956 Brachypodium distachyon Si. TPS 17 Setaria italica 82 Zm. TPS 4 -B 73 Zea mays 100 Zm. TPS 5 -Del 1 Zea mays Zm. TPS 23 -Del Zea mays 0, 1 Supplemental Figure S 6. Dendrogram analysis of Poaceae TPS-a genes from clade II. The tree was inferred by using the Maximum Likelihood method based on the Kimura 2 -parameter model (Rates among sites, G+I). Bootstrap values (n = 1000 replicates) are shown next to each node. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Maize Zm. TPS 23 -Del was included as outgroup. Characterized terpene synthases are shown in red. TPS enzymes characterized in this study are shown in blue.

Pv. TPS 08 Panicum virgatum 98 100 Si 021506 m Setaria italica Zm. TPS

Pv. TPS 08 Panicum virgatum 98 100 Si 021506 m Setaria italica Zm. TPS 15 -B 73 Zea mays 93 Pv. TPS 04 Panicum virgatum 72 clade III ancestor 100 Si 016692 m Setaria italica BAJ 86978 Hordeum vulgare Zm. TPS 26 -B 73 Zea mays 100 Zm. TPS 19 -B 73 Zea mays clade II ancestor 0. 1 Supplemental Figure S 7. Dendrogram analysis of Poaceae TPS-a genes from clade III. The tree was inferred by using the Maximum Likelihood method based on the Kimura 2 -parameter model (Rates among sites, G+I). Bootstrap values (n = 1000 replicates) are shown next to each node. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The clade II ancestor was included as outgroup. Characterized terpene synthases are shown in red. TPS enzymes characterized in this study are shown in blue.

>clade I ancestor optimized ATGGCGACCACGGTAGCCACAGTATTGCCCTTAGCTGAGAAAGACGAACAGCGCAATCCACGCCCTTATCACCCGAGCCTTTGGGGCGACTTC TTCCTCAACTACAAACCTTGTACGCCGTCACAGCATTTATCCATGAAAGATAAGGCTGAAGTCATGAAAGAAGAAGTACGGAAAATGATTCTT GATACCGCATCCAGCTCAGATCTGCCGTTAAAACTCGTTGACACTCTGCAACGCCTTGGTCTGGACTATCGCAAGGAAATT GATGAACTCTTGTGTGGCATTCACGAGGGTGGAGATGATGATCACGATCTCCACACGACGAGCCTTCGGTTCTACTTGCTTCGCAAACATGGT TACCATGTTTCTTCTGACGTGTTTCTCAAATTCCGCGATGACGAAGGCAACTTCGCCAGCAATGATACGCGCAGTTTACTGGCGTTATACAAT GCCGCTCATTTACGTACCCATGGTGAGGAGATCTTAGATAACGCGATCGTCTTTACGAAGAATCATCTGCAGTGGTCGAGGATCTGGAA AGTCCATTGGCAGACGAAGTCCGTTGTACCTTGGAAACCCCGTTATTTCGTCGCCTTAAGCGTGTTGAAGCCCGGCACTATATCAGTGTATAC GAGAAAATGACAACTCGCAACGAAACCATCTTGGAATTTGCCAAATTGGATTTTAACATCTTGCAGACCCTGTATTGCGAGGAACTGAAAGCC CTGACCATTTGGTGGAAAGAACTGCAGCTGCAAGCGGACCTGAGTTTTGCACGTGATCGCATGGTGGAAATGCACTTTTGGATGCTGGGTGTG CTGTTTGAACCGCAGTATAGCTATTCGCGCATTATGCTGACCAAACTGTTCATTTTCGTGTCGATTTTCGATGACATTTATGACAATTACTCT

>clade I ancestor optimized ATGGCGACCACGGTAGCCACAGTATTGCCCTTAGCTGAGAAAGACGAACAGCGCAATCCACGCCCTTATCACCCGAGCCTTTGGGGCGACTTC TTCCTCAACTACAAACCTTGTACGCCGTCACAGCATTTATCCATGAAAGATAAGGCTGAAGTCATGAAAGAAGAAGTACGGAAAATGATTCTT GATACCGCATCCAGCTCAGATCTGCCGTTAAAACTCGTTGACACTCTGCAACGCCTTGGTCTGGACTATCGCAAGGAAATT GATGAACTCTTGTGTGGCATTCACGAGGGTGGAGATGATGATCACGATCTCCACACGACGAGCCTTCGGTTCTACTTGCTTCGCAAACATGGT TACCATGTTTCTTCTGACGTGTTTCTCAAATTCCGCGATGACGAAGGCAACTTCGCCAGCAATGATACGCGCAGTTTACTGGCGTTATACAAT GCCGCTCATTTACGTACCCATGGTGAGGAGATCTTAGATAACGCGATCGTCTTTACGAAGAATCATCTGCAGTGGTCGAGGATCTGGAA AGTCCATTGGCAGACGAAGTCCGTTGTACCTTGGAAACCCCGTTATTTCGTCGCCTTAAGCGTGTTGAAGCCCGGCACTATATCAGTGTATAC GAGAAAATGACAACTCGCAACGAAACCATCTTGGAATTTGCCAAATTGGATTTTAACATCTTGCAGACCCTGTATTGCGAGGAACTGAAAGCC CTGACCATTTGGTGGAAAGAACTGCAGCTGCAAGCGGACCTGAGTTTTGCACGTGATCGCATGGTGGAAATGCACTTTTGGATGCTGGGTGTG CTGTTTGAACCGCAGTATAGCTATTCGCGCATTATGCTGACCAAACTGTTCATTTTCGTGTCGATTTTCGATGACATTTATGACAATTACTCT ACCACCGAAGAATCGAAAATCTTTACCACCGCGATGGAACGTTGGGATGAAGAGGCAGCAGAGCAACTGCCGGGCTATATGAAAGCGTTTTAC ATTAACATTCTGACCACGATTAACGCGATTGAAGAAGAGCTGAAGCTGCAGAAGAACACGCCGACTATGTGAAGAAACTGCTGAT GTGACCAAATGCTACTACGATGAGGTCAAATGGCGCGATGAGCATTATGTGCCGGCTACGGTAGAAGAACATCTGCAGATCAGCGTTCCGAGT AGCGGATGCACATTGCTTCACTGGCGTTCATTAGCATGGGCGATGTGACGACTTCCGATGCGATCGAATGGGCGCTGACTTATCCCAAA ATCATCCGTGCCTTTTGCATTGTTGGGCGTATTGTTAACGATATTGCGTCCCATGAACGTGAACAGGCATCGGAACATGTCGCGTCTACTGTT CAAACTTGCATGAAAGAATATGGGATCACAATCGAAGAAGCTTATGAGAAACTGCGCGAACTGATTGAGGAGAGCTGGACATTGTGGAA GAATGTCTGCGTCCAGCCCAGACCCAACCGACAGCCCTGCTGGAAACAGTTGTGAATCTGGCACGTACCATGGATTTTCTGTATAAAGACGAG GATGCGTACACTCATCCTCGCACGCTGAAAGACATCATCGACTCCATGTACGTCAATTCGATCTAA >clade II ancestor optimized ATGGCGGCTGCGCCAGCAGATGGTTCCGGTACCGATGACCAGGGCTTACAGAAAGCCTCAACCACGTTTCATCCGTCATTATGGGGAGATTTC TTCTTGACCTATCAACCGCCAACAGCACCCCAACATGCCCACATGAAAGAACGCGCTGAAGTTCTCCGTGAGGAAGTTCGCAAAATGGTCAAA GGCTCGAATGAGATTCCGGAAATTCTTGATTATCACGCTCCAACGCTTAGGCTTGGATTACCACTATGAGAACGAAATCGATGAGCTG TTACGGGTGGTATACAATTCGGATTATGACGATGATGATCTGAACCTGGTAAGCCTGCGCTTTTACTTGCTGCGCAAGAACGGTTACGACGTA TCGTCTGATGTCTTTCTGAAGTTCAAGGACAAAGAAGGCAATTTCGTTGCGGATGACACCCGTAGTCTGCTGAGCCTGTACAATGCTGCGTAT TTACGCACTCATGGCGAGAAAGTGCTGGATGAGGCGATTGCCTTTACTCGTAGTCGTCTGCAAGGGGCATTGGAACATCTGGAATCACCTCTG GCTGAAGAAGTTCTGCGCTGGAAACGCCGCTCTTTCGTCGGGTTGGCATCCTTGAAACCCGTAACTATATTCCGATTTATGAGAAGGAA GCCACCCGCAATGAAGCCATCCTGGAATTTGCGAAACTGAACTTTAACTTACTGCAGTTATTGCGAGGAACTCAAAGAGGTGACATTA TGGTGGAAAGAACTGAATGTGGAAAGCAACCTGAGTTTTGTGCGCGATCGCATTGTAGAAATGCACTTCTGGATGACCGGTGCAGTGAA CCGCAGTATTCTCTGAGCCGCATTATCCTCACGAAAATGACCGCCTTCATCACCATCCTTGACGACATCTTTGACACATATGGCACCACTGAA GAATCCATGCTGCTGAAGCGATTTATCGTTGGGACGAGAATGCAGCCGCCCTTCTCCCTGAATACATGAAAGATTTCTACCTGTATCTG CTGAAAACCTTCGATAGCTTCGAAGATGAACTGGGTCCAGATAAATCCTATCGCGTGTTTTACCTTAAAGAGGTCCTTAAACAGCTGGTCCGT GGCTATTCTGAAGAAATCAAGTGGCGTGACGAAAACTATGTGCCGAAAACGATCAATGAGCATCTGGAGGTGTCGATCGTCAGCATTGGAGCC GTCCAGGTTGCGTGTTCCAGCTTCGTGGGTATGGGTGACATTATTACGAAAGAGACTTTGGACTGGGTCTTGACGTACCCCGAACTGGTGAAG AGCTTTGGGACTTTTGTTCGCCTCAGCAACGATATTGCGTCGACAAAACGCGAACAAACTGGGGATCATTCTGCGTCGACGGTGCAATGCTAT ATGAAAGAACACGGCACGACCATGCACGATGCATGTGAGAAAATCAAAGAACTGATTGAAGATTCATGGAAAGACATGATTCAGCAGTATCTG GCCCCAACGGAGCAGCCGAAAGTTGTTCCGCGTACCGTGGTAGACTTTGCACAGCGGATTACATGTACAAACAGACCGATGCATTTACC AGTAGCCATACCATTAAGGATATGATCGCTTCCCTGTACGTGGAACCGATTCCTCTGTAA >clade III ancestor optimized ATGGCCGGCGGAGTAACGTCCACCGGTAAACGTATGCCGACAACCGCCTTTTGTCTGCGTACTCGCGAATGCTCAGGTAGCTGTCTGCCGGCT GCAGCGGCGGCAGCCGGTCCAAGCGGCCCTGCAACGGAGGCTGAAGATGATGATCGGTTGTCCAAGAATCCTAGCAGTTTTCATCCGTCTATC TGGGGCGATTTCTTCCTCACGTACTCTAATCCAGCGGCAAGCAGTCAGCAGCAAACCTGGATGGTCGAGCGCGCGGAGAAACTGAAAGAAGAA GTCGCGAAAATGATTGCCAGTTCTAATGCCTGTGGCCTGCATGAGCGCATTCACTTGACGCGTTGGAACGCCTCTGTTTGGATTACTTA TTTGAGGATGAAATTAACGATGCTTTAGCGCAGATTAATAACGCAGATGTTAGCGACTGTGACCTCCATACCGTTGCGATGTGGTTTTATCTG TTACGCAAACATGGGTATCGCGTATCCAGTGATGTCTTTGTCAAATTTAAGGACGAAGAAGGTAGCTTCATTGCGAACAATCCCCGTGATCTG CTGTCGTTATACAATGCGGCACATCTGGGCACTCATGGCGAAACCATCTTAGACGAAGCTATCTCCTTCACTCGTCGTCGCTTGGAAACCATT CTTCCGTATCTGGAAGCCTCACTGGCACATGAGATCAAATGTGCCCTCGAAATTCCGTTGCCACGTCGCGTTCGCATTTATGAGGCGAAATAC TACATCAGCACATACGAAAAGGAAGCCACCGTGAACTGGTATTAGAGCTGGCGAAACTGAACTCTAATCTGATGCAGTTGCATCACCAA CAAGAGCTGAAAATCATTACGCGTTGGTGGAAAGACTTAGAAATTGAATCGCGTTTACCCTTTGCTCGCGATCGCGTCGTTGAATGCTACTTC TGGATGCTGGGAGTGTACTTTGAACCTAGTTATTCACGTGCACGCATTATTCTCACGAAGGTGATCGCCATTGTTACGATTCTGGACGATATT TACGACTCGTATGGTACTCCGGAGGAATGTGAACTGCTGACTAAATGCATCGAAAGCTGGGATACCAAAGTAGCAGGCGATCTGCCGGAATGC ATGAAATATGCGTTTGGGAAGATCCTCGACACATACGAAACAATCGAAAACGAACTGGCTCCGGAAGAGAAATACCGTATGCCATATCTGAAG AACTTCATTATCGACCTTGTGCGCGGCTATAACAAAGAAGTCAAATGGCGGGAAGAGGGCTATGTGCCGAAAACCGTAGAAGAGCATTTGCAA GTTAGCGTGCGCTCAGGTGCCACCTTCTTGCGCCTCGTTTGTGGGTATGGGTGACATTGCGACCAAAGACAGCTTTGAGTGGGTG AGTACCGTCCCGAAAATTGTTCAGGCCCTTTGCATCATTCTGCGTCTGTCGGATGATCTTAAATCCTATGAGCGCGAACAGATGATTCCTCAC GTGGCATCAACCATCGAATCCTATATGAAAGAACACAACGTGAGCATTGAGGTTGCGCGCGAGAAGATCCAGGAGCTGATTGAAGAATCGTGG AAAGACTTCAACGGGGAATGGCTGAACCCCGATAACGATCAACCGCGTGAACTGCTGGAACGGATCTTTAACCTGACGCGCACCATGGAATAT ATGTATAAACAGGATGATGCGTTTACGAATTGCCACAATATCAAAGATACCATCCACTCTCTGTTCGTGGAACCGTTCGCTATTGCCCTGTAA Supplemental Figure S 8. Codon-optimized sequences of the clade I ancestor, clade II ancestor, and clade III ancestor. Sequences were synthesized, cloned, and used for heterologous expression in E. coli.