Topic RELATIONSHIPS AND BIODIVERSITY LAB Aim How do
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus? NOTE: READ ANSWER DO NOW: (5 MINUTES) THE QUESTIONS BELOW. AGENDA 03/04/09 DO NOW: • Silent Reading MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ REFLECTION HOMEWORK Castle Learning Botana curus is a valuable plant because it produces CUROL, a substance used to treat certain type of canc Curol is not produced in the laboratory. Botana curus rows very slowly and is on the endangered species Li Species that are most closely related to Botana curus might produce Curol. These 3 similar plant species ar SPECIES X, SPECIES Y and. SPECIES Z. One of them i closely related to Botana curus and could able to produce curol. QUESTIONS: 1. Why is Botana curus considered as a valuable plan 2. What is curol? 3. What are the problems about Botana curus
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus? AGENDA 12/18/0 03/04/09 DO NOW: • • Silent Reading MINI LESSON: • • Gathering structural Evidences to prove relationships • • Formulating hypothesis ACTIVITY: • • Observing structural characteristics of of Botana curus and species XYZ REFLECTION HOMEWORK REFLECTION Castle Learning HOMEWORK Castle Learning MINI LESSON: (10 to 15 mins ) Botana curus is a valuable plant because it produces Curol, a compound used for treating certain kinds of cancer. Curol can not be produced in the laboratory. Botana curus grows very slowly and is on the endangered species list, so its ability to provide curol in large quantities is limited.
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus? AGENDA 03/04/09 12/18/08 DO NOW: • • Silent Reading MINI LESSON: • • Gathering structural Evidences to prove relationships • • Formulating hypothesis ACTIVITY: • • Observing structural characteristics of of Botana curus and species XYZ REFLECTION HOMEWORK Castle Learning
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus? AGENDA 12/18/08 03/04/09 DO NOW: • • Silent Reading MINI LESSON: • • Gathering structural Evidences to prove relationships • • Formulating hypothesis ACTIVITY: • • Observing structural characteristics of of Botana curus and species XYZ REFLECTION HOMEWORK REFLECTION Castle Learning HOMEWORK Castle Learning TABLE 1: STRUCTURAL EVIDENCES SPECIES BOTANA CURUS SPECIES X SPECIES Y SPECIES Z Structural Characteristics of Plant (color of leaf&petals) Structural Characteristi cs of Seeds (color and shape of seeds, ) Microscopic Stem Structure (scattered or circular)
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus? AGENDA 03/04/09 12/18/08 DO NOW: • • Silent Reading MINI LESSON: • • Gathering structural Evidences to prove relationships • • Formulating hypothesis ACTIVITY: • • Observing structural characteristics of of Botana curus and species XYZ REFLECTION HOMEWORK Castle Learning Structural Characteristic of Plants
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus? AGENDA 03/04/09 12/18/08 DO NOW: • • Silent Reading MINI LESSON: • • Gathering structural Evidences to prove relationships • • Formulating hypothesis ACTIVITY: • • Observing structural characteristics of of Botana curus and species XYZ REFLECTION HOMEWORK Castle Learning Structural Characteristic of Seeds
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the Compare Stem Structures species related to Botana curus? AGENDA 03/04/09 12/18/08 DO NOW: • Silent Reading • MINI Silent Reading LESSON: MINI LESSON: • Gathering • structural Gathering Evidences structural to prove Evidences to prove relationships • Formulating • hypothesis Formulating hypothesis ACTIVITY: • ACTIVITY: Observing • structural Observing structural characteristics of Botana curus and Botana species curus XYZ and species XYZ REFLECTION HOMEWORK Castle Learning Microscopic Stem Structure. SCATERRED OR CIRCULAR? Botana curus Species X Species Y Species Z
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do HYPOTHESIZE: we gather evidences to determine TESTS 1 -3 the species related to Botana curus? AGENDA 03/04/09 12/18/08 DO NOW: • Silent Reading • MINI Silent Reading LESSON: MINI LESSON: • Gathering • structural Gathering Evidences structural to prove Evidences to prove relationships • Formulating • hypothesis Formulating hypothesis ACTIVITY: • ACTIVITY: Observing • structural Observing structural characteristics of Botana curus and Botana species curus XYZ and species XYZ REFLECTION HOMEWORK Castle Learning Formulating Hypothesis A. Base on your data for structural relationships, which species ( X, Y, Z) would you hypothesize is most likely to produce CUROL? _____ B. Explain how the evidence from your data table supports your hypothesis.
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus? TABLE 1: MOLECULAR EVIDENCES AGENDA 12/18/08 03/04/09 DO NOW: • Silent Reading SPECIES • Silent Reading MINI LESSON: • Gathering structural Evidences to to prove relationships • Formulating hypothesis BC hypothesis ACTIVITY: • Observing structural SPECIES structural characteristics of X Botana curus and species XYZ SPECIES species XYZ Y REFLECTION HOMEWORK Castle Learning SPECIES Paper Test for Chromatog ENZYME raphy(colo M r) (present / absent) Difference s in Amino Acid Sequence s Gel Electroph oresis Banding Pattern
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus? AGENDA 03/04/09 DO NOW: • Silent Reading MINI LESSON: • Gathering structural Evidences to prove relationships • Formulating hypothesis ACTIVITY: • Observing structural characteristics of Botana curus and species XYZ REFLECTION HOMEWORK Castle Learning TEST # 4: Paper Chromatography
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus? Testing for “M” Botana curis Species Y Species X Species Z Record the results of your tests for enzyme “M” (either a Positive or Negative result) in Table 1
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus? Base Pair Rule DNA : GCAT GAA CTT RNA : GCAU CAC GUG GGA CTC CCT GAG GTG CAC GTA CAU
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus? Translating DNA Code to Make Proteins BOTANA CURUS Sequence of bases in m. Rna Produced Sequence of amino Acids in the protein CAC GTG GAC GUG CAC CUG TGA GGA ACU CTC GAG _______________________________ VAL HIS LEU THR PRO GLU CTC
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus?
Topic: RELATIONSHIPS AND BIODIVERSITY LAB Aim : How do we gather evidences to determine the species related to Botana curus? Gel Electrophoresis Separation of DNA Fragments
GEL ELECTROHORESIS BANDING PATTERN BC: ATTCCGGATCGCCGGATATACTCCGGTTATATC 5 X : 127 - 22 ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC 3 Z : 9 ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA 8 Y : 11 - 5 12 - 17 ATTCCGGATCGCCGGATATACTCCGGTTATATC 5 - 12 - 11 - 9
- Slides: 16