This presentation was originally prepared by C William

This presentation was originally prepared by C. William Birky, Jr. Department of Ecology and Evolutionary Biology The University of Arizona It may be used with or without modification for educational purposes but not commercially or for profit. The author does not guarantee accuracy and will not update the lectures, which were written when the course was given during the Spring 2007 semester.

Introduction • How do we detect genes? 1. Detecting phenotypic changes in the organism due to changes in the gene. 2. Screening DNA sequences for ORFs with gene-like features or similarities to genes already known. • A mutation is a change in base sequence of a gene, or in the arrangement of genes on a chromosome (chromosome mutation, discussed more later). • A mutation produces a new allele of the gene. • The most common allele in a laboratory stock or wild population of an organism is called the wild type allele; then a mutation produces a new mutant allele. • A mutant is an individual carrying a mutant allele. Wild type Drosophila on the left; each of the three mutants is in a different gene.

Some Kinds of Mutations wild type ATGACCATGA base pair substitution AGGACCATGA AAGACCATGA ACGACCATGA insertion ATGGACCATGA ATGTTCACCATGA Deletion d. T AGACCATGA d. TG AACCATGA d. TGA ACCATGA • Changes of 1 bp (or a few contiguous bp) are called point mutations. • Also possible but much less frequent are substitutions of ≥ 2 bp at one time. • Transposable elements cause insertions of 102 - 104 bp.

Mechanisms of Point Mutation (partial list) 1. Most are due to errors in DNA replication: replication repair GATC --> GATC or GGTC CTAG CCAG Repair occurs during proofreading or later. Slip-strand mispairing causes short repeats: NNNNNNAGCAGCAGC … NNN e. g. Huntington’s disease, (AGC)n, an in-frame repeat encoding poly(Glu). The resulting polypeptide causes cell death in parts of the brain and dominant neurological problems. (N stands for nucleotide, i. e. any base. ) 2. Some are due to spontaneous changes in bases, e. g. C --> deamination --> U

Mechanisms of Point Mutation (continued) H. J. Muller 3. Some mutations are caused by mutagens Chemical mutagens modify bases so they cause mispairing when replicated or are repaired incorrectly. UV radiation links adjacent pyrimidines to form dimers, which may be repaired incorrectly. Ionizing radiation induces single- or double-stranded breaks, chemically modifies bases, or cross-links bases; may be repaired incorrectly.

When and Where Mutations Happen Mutations are stochastic events (unpredictable, random): we can never predict exactly when a mutation will occur or what kind of mutation will occur, but we can assign a probability (frequency or mutation rate) to it. Most mutations happen during cell division, so we usually measure the rate in mutations per cell division. Measured mutation rate would be 7 mutations/31 cell divisions or 0. 226 mutations/cell division (unrealistically high example!).

When and Where Mutations Happen In eukaryotes, mutations that occur in the somatic cells (somatic mutations) are not inherited; mutations that occur any time in the germ line are inherited. We usually measure the rate in mutations per gamete somatic mutation Soma Germ line germ line mutation

Mutation Rates Mutations are stochastic events (unpredictable, random): we can never predict exactly when a mutation will occur or what kind of mutation will occur. We can measure the rate at which a given kind of mutation will occur. The rate is the probability that it will occur in a unit of time. Orders of magnitude: animals and plants 10 -6 - 10 -4 muts per gene per gamete 10 -10 - 10 -8 muts per bp per year (from evolution rates) 10 -9 muts/bp year 3 10 9 bp > 1 new mutation in each gamete (we are all mutants!) Drosophila: u = 8. 4 10 -9 muts/bp year bacteria 10 -10 - 10 -6 muts per gene per cell division U = 1. 2 detrimental mutations/2 N genome How to write rates so they can be used in dimensional analysis: 10 -9 muts per bp per year 10 -9 muts/bp year NOT 10 -9 muts/bp/yearbecause that is 10 -9 muts year /bp Mutagenesis increases the rate (probability) but the mutations are still stochastic.

Mutation Rates A given mutagen increases the rate of some kinds of mutations but not others. In other words, it biases the probabilities, like weighting a coin. e. g. • Ionizing radiation induces (increases the probability of) chromosome breaks and hence of large-scale “chromosome mutations” or rearrangements such as deletions or translocations. • Acridines induce deletion or insertion frameshifts. • Ethyl methan sulfonate (EMS) induces chemical changes in bases, mainly changing guanine to O 6 -ethylguanine which mispairs, resulting in changing GC pairs to AT. • 5 -bromouracil (Bu) is an analogue of thymine and is most often incorporated into DNA in place of thymine. It then pairs with G at the next replication, so that an AT pair is replaced by a GC pair. Less commonly it causes a GC pair to be replaced by AT. Modern genetic engineering can reduce or eliminate the stochasticity of mutation, allowing us to change a specific base in a specific gene in vitro, then put it back in the organism. Knockout mutations can be made in specific genes in vivo.

Phenotypic Effects of Mutations in Exons Review code properties: • Degenerate • Triplet • Commaless • Start codon • Stop codon(s)

Phenotypic Effects of Mutations Useful terms for phenotypes of mutations: Amorph = nullimorph = null = knockout mutations: mutant allele is completely inactive (not transcribed, or translated, or encodes inactive protein or RNA). e. g. white eye mutant in Drosophila melanogaster Hypomorph: mutant allele has reduce activity (reduced rate of transcription or translation, or encodes protein or RNA with reduced activity). e. g. apricot eye allele of white gene in D. melanogaster Neomorph = gain-of-function mutation: mutant allele has new activity (e. g. encodes protein or RNA with new enzymatic activity or turns one gene off and another one on or make a gene active in wrong tissue). e. g. Antennapedia in Drosophila The “morph” terminology was devised by H. J. Muller, who used it mainly to refer to mutation effects inferred from phenotypic effects.

Consequences of Code Properties Degenerate

Consequences of Code Properties • Degenerate, therefore in an exon of a protein coding gene there are two kinds of point mutations: Synonymous mutations change a codon to a synonymous codon and do not change an amino acid Nonsynonymous = missense mutations change an amino acid

Consequences of Amino Acid Changes Synonymous mutations do not change an amino acid. Therefore they usually have no effect on phenotype. Nonsynonymous = missense mutations change an amino acid. The phenotypic effect depends on the nature of the change and the location in the protein: Some changes have no effect on protein function, therefore no effect on phenotype. Changes that are more likely to have an effect include: • Changing to amino acid with very different side chain (charge, hydrophobicity, etc. ). • Change in active site or ligand binding site or site required for folding or joining with other polypeptides. • Changes on outside of molecule that affect hydrophobicity or charge of protein. Hemoglobin. Heme in red, two a and two b chains in different colors.

Phenotypic Effects of Mutations • Triplet • Commaless

Phenotypic Effects of Mutations • Triplet • Commaless Deletions of 1 or 2 bp are frameshift mutations. Consequences: Met Val His Leu Thr Pro Glu His Term CACCATGGTGCACCTGACTCCTGAG…CACUA Met Val Thr Term CACCATGGTGACCTGACTCCTGAG…CACUAA Met Val -C Pro Asp Ser Leu Thr Arg Term CACCATGGTGCCACCTGACTCCTGAG…CACU +C Met Val His ? Leu Ser CACCATGGTGCACCTGACTCGAG…CACUAAG - CT

Phenotypic Effects of Mutations Deletions of 1 or 2 bp in exons are frameshift mutations. Consequences: • Change of one or more amino acids; phenotype depends on the amino acids and their location. • Premature termination. • Late termination. • Usually nullimorphs or hypomorphs. Met Val His Leu Thr Pro Glu His Term CACCATGGTGCACCTGACTCCTGAG…CACUAA Met Val Thr Term (termination, or stop) CACCATGGTGACCTGACTCCTGAG…CACUAAG Met Val -C Pro Asp Ser Term CACCATGGTGCCACCTGACTCCTGAG…CACUA +C Met Val His Leu Thr Arg ? Leu? Ser? CACCATGGTGCACCTGACTCGAG…CACUAAG - CT

Phenotypic Effects of Mutations in Exons • Start codon • Stop codon Copyrighted figure removed.

Phenotypic Effects of Mutations in Exons Any change in start codon • Late start, first part of polypeptide missing. • Out-of-frame start. Likely result is polypeptide with no function (nullimorph) or abnormal function (hypomorph). Copyrighted figure removed. Change of stop codon to a sense codon • Polypeptide has extra segment at the end. Possible result is polypeptide with no function, reduced function, or abnormal function (amorph, hypomorph, or neomorph). Nonsense mutations change a sense codon for an amino acid to a nonsense = stop codon. • Shortened polypeptide which usually, but not always, has reduced or no function.

Mutations Due to Transposable Elements Transposable elements (TEs) are segments of DNA that can move from one location to another in the genome, or have a copy made and moved to a new location. Insertion of a TE in a gene can cause frameshifts or cause additional amino acids to be added to a protein product. This usually results in a null mutation. Insertion of TEs in controlling elements or between a gene and its controlling elements can cause major changes in transcription (no transcription or transcription at inappropriate times and/or places. Transposable elements are more common in some organisms (e. g. Drosophila melanogaster) than in others and can cause a major proportion of all visible mutations.

Genes Encoding Enzymes and Auxotrophic Mutants Some genes code for enzymes. Many enzymes catalyze steps in biosynthetic pathways. Steps are sequential, enzymes act sequentially. Usually, 1 enzyme catalyzes 1 reaction or step in a pathway. Genes G 1 G 2 G 3 Enzymes E 1 E 2 E 3 A B C D Chorismic acid e. g. tryptophan biosynthesis in E. coli: Text says 5 steps but don’t show the pathway. Notice that names of genes are italicized (or underlined). Anthranilic acid ASase trp. E PRTase trp. D In. GPSase trp. C TSase. B trp. B TSase. A trp. A PRA CDRP In. GP Indole L-Tryptophan

Genes Encoding Enzymes and Auxotrophic Mutants Special classes of mutants especially useful with microorganisms: Antibiotic-resistant Auxotrophic: can’t make essential nutrient, must be supplied in culture medium • Test for growth on minimal medium (MM) which has things wild type needs (energy, C, N sources; salts; etc. ); only wild type (prototroph) grows, because it can make everything it needs from these simple ingredients. • Control is complete medium (CM) which has yeast extract, proteose peptone, etc. that supply everything; all genotypes grow. One Gene - One Enzyme Hypothesis: not quite right, but focused on idea that genes have their phenotypic effects by encoding proteins.

Tryptophan Auxotrophs Chorismic acid Anthranilic acid ASase trp. E PRTase trp. D In. GPSase trp. C TSase. B trp. B TSase. A trp. A PRA CDRP In. GP Indole L-Tryptophan

Visible Phenotypes of Pathway Mutants cinnabar Drosophila melanogaster wild type has red eyes, which require a number of pigments. Makes eye pigment xanthommatin from tryptophan. cinnabar (cn+) gene encodes kynurenine-3 -hydroxylase. cinnabar (cn) mutant has cinnabar-colored eyes.

Phenotypic Effects of Mutations in Introns Usually no effect unless mutation in splicing signal sequence --> failure to remove intron or splicing at incorrect site. ATG GTG CAC … GCAGgttggtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggag Acagagaagactcttgggtttctgataggcactgactctgcctattggtctattttcccacccttag. GCTGCTG GTGATGGTGCAC … GCAGGCTGCTGG DG No splicing, wrong amino acids up to a stop codon ATG GTG CAC … GCA Ggt ggt atc aag gtt aca aga cag gtt taa gga gac caa tag aaa ctg ggc atg tggagacagagaagactcttggg ttt ctg ata ggc act gac tct ctc tgc cta ttg gtc tat ttt ccc acc ctt ag. G CTG GTG

Phenotypic Effects of Mutations in Genes Encoding Functional RNAs r. RNA genes Complicated because r. RNA genes present in hundreds or thousands of copies (tandem repeats); mutation affects only one, in which case has little or no effect, but can spread to all copies after many generations. The mechanism of spreading is unequal crossingover and gene conversion, which we will discuss later in the course. If it spreads, can have no effect, nonfunctional or subfunctional RNAs and ribosomes, no or reduced synthesis of all proteins encoded same genome. Often lethal or very detrimental.

Phenotypic Effects of Mutations in Genes Encoding Functional RNAs t. RNA genes Mutations in the anticodon, or in the region that is recognized by the aminoacyl t. RNA synthetase, can result in wrong amino acids being inserted at many sites in many proteins.

Mutations and Gene Interactions Gene A Gene B Control of gene expression involves interaction with the products of other genes. (More detail in next section of lectures. ) • Sometimes, whether a gene is transcribed or not depends on whether or not a protein produce of another gene binds to an upstream controlling region. • Mutations in controlling gene can modify presence/absence or abundance of product of controlled gene. • There are many other ways in which products of different genes interact. • Consequence: change in expression of a gene may be due to mutation in gene itself, or in its control sequences, or in other genes that interact with it. • What appears to be a mutation in gene B could be a mutation in gene A if A encodes a protein that is required for transcription of B.

Dominance An important aspect of genetics is being able to relate the genotype with respect to a particular gene to the phenotype. Dominance: allele A 1 is dominant to allele A 2 if the heterozygote A 1/A 2 has the same phenotype as the homozygote A 1/A 1. Dominance of a mutant allele depends on the effects of the mutation at the molecular level. e. g. a null alllele will be recessive to the wild type in a gene that codes for a product that is detected fairly directly. You are invited to try to predict the phenotypes of heterozygotes for various kinds of mutations.

Mutation Summary Mutations can result from: • errors in DNA replication or repair • damage by chemical or radiation mutagens • movement of transposable elements The effects of mutations depend on: • the kind of gene in which the occur • the function (or lack thereof) of the site within the gene • the nature of the mutation • interactions of the mutant gene or sequence with other genes