The Sciurus Case of the Black Squirrel Context
The Sciurus Case of the Black Squirrel
Context • Biology 1113, Biology 1101 • Research on student learning of the Central Dogma has recommended using a pre-assignment before engaging students in model-based learning of genes-to-phenotype molecular processes (Reinagel & Speth 2016). • We suggest instructors ensure the following concepts have been covered prior to using this tidbit: • • • Transcription/translation (regulation) Some familiarity with evolution Protein structure and function Possibly genetics and heredity Cell signaling (specifically G protein-coupled receptors)
Motivation
Learning Goal • Students will explain how cellular and molecular processes can provide variability on which natural selection can act at the population level and recognize this in multiple biological systems.
Learning Outcomes 1. Students will trace the consequences of a change in DNA to changes in proteins. (Aligns with Bio 1113 Learning Outcome 3 b) 2. Students will predict effects of lower level changes on higher/upper organizational levels under different conditions. (Aligns with Bio 1113 Learning Outcome 3 b) 3. Students will predict potential effects of these changes in different environments. (Aligns with Bio 1113 Learning Outcome 4 c) 4. Students will interpret graphs and figures related to the model system. (Aligns with core competencies of AAAS Vision and Change 2011 report) 5. Students will apply their understanding of the model system to novel contexts. (Aligns with Bio 1113 Learning Outcome 4 b and core competencies of AAAS Vision and Change 2011 report)
Instructions • Work together in groups of 3 or 4 (aka your lab groups). • Put all names on one paper and submit to your TA at the end. • Discuss with each other and the instructors; we’ll have clicker questions throughout to assess your understanding and guide our discussion.
Work on questions 1 & 2 in your groups. • WQ 1: Where does this variation come from? • WQ 2: Draw a flowchart
Read pages 2 -3 describing the molecular mechanisms of color and answer question 3. • WQ 3: What mutations might result in a lighter squirrel? A darker squirrel? Can you think of any mutations that aren’t changes to the MC 1 R receptor?
Molecular control of squirrel color Figures 1 and 2 in your activity (adapted from Mc. Robie, Thomas and Kelly, 2009) summarize the mechanism by which different colors are produced in squirrels. Refer to these figures to answer the following questions.
Many signaling pathways are “turned on, ” by binding of a specific ligand to a G protein-coupled receptor. How do such pathways “turn off? ” A. The ligand is removed from the receptor by another enzyme. B. The G protein hydrolyzes GTP. C. An “off” receptor is needed to turn off the signal. D. Two GPCRs dimerize and phosphorylate each other.
What would happen if ASIP was constantly expressed at a high level? A. Eumelanin synthesis would decrease, resulting in a darker squirrel. B. Eumelanin synthesis would increase, resulting in a darker squirrel. C. Eumelanin synthesis would increase, resulting in a lighter squirrel. D. Eumelanin synthesis would decrease, resulting in a lighter squirrel.
ASIP is what kind of inhibitor? (In the case of receptor-ligand binding, we would call the inhibitor an antagonist. ) A. B. C. D. Allosteric Competitive Noncompetitive Uncompetative
Which mutation(s) would you expect to result in a darker squirrel? A. A mutation that causes MC 1 R to be constitutively active B. A mutation that prevents transcription of the MC 1 R gene C. A mutation that increases transcription of α-MSH D. A and B E. A and C
Which mutation(s) would you expect to result in a lighter squirrel? A. Constitutive expression of MC 1 R B. Overexpression of α-MSH C. Deletion of a crucial gene involved in eumelanin synthesis D. Deletion of the gene encoding ASIP E. Spray painting all squirrels
WQ 3: What mutations might result in a lighter squirrel? A darker squirrel? Can you think of any mutations that aren’t changes to the MC 1 R Lighter squirrel: receptor? • Loss of α-MSH or inactive Darker squirrel: • α-MSH overexpression • Constitutively active mutant form of MC 1 R • Mutation in MC 1 R that prevents ASIP binding • No expression of ASIP or inactive mutant form • Mutations or overexpression in response signaling pathway resulting in increased or constitutive activity • • mutant form Overexpression of ASIP Loss of MC 1 R or inactive mutant form Defects in the response signaling pathway Defects in melanin synthesis pathway
Part of the MC 1 R DNA and amino acid sequence is shown below. Deletion of the 24 bases in red (the EB allele) was identified by Mc. Robie, Thomas and Kelly (2009) as the likely cause of socalled “melanistic” phenotypes atgcctgtacagaggaggctcctgggctctctcaactccacccccatggccacccctcag M P V Q R R L L G S L N S T P M A T P Q ctccggctaccagaccggcccccagtgcctgctggtatccattcctgatggg L R L A T N Q T G P Q C L L V S I P D G ctcttccttggcctggggctggtgagcttggtggagaacatgctggtggtggttgccatt L F L G L V S L V E N M L V V V A I gccaagaaccgcaacctgcactctcccatgtactgcttcatctgctgcctggccctgtcg A K N R N L H S P M Y C F I C C L A L S gacctgctggtgagcaccagcaacgcactggagacgaccatcttcctactgctggaggtg D L L V S T S N A L E T T I F L L L E V ggtgccctggcaacgccagctaccgtggtgcagcagctggacaatgtcatcgacgtgctc G A L A T P A T V V Q Q L D N V I D V L acctgtggctccatggtgtccagcctttgctttttgggtgccattgccgtggaccgctac T C G S M V S S L C F L G A I A V D R Y
What are the potential effects of this 24 base deletion (the EB allele) on the MC 1 R protein in S. carolinensis? A. B. C. D. Truncation of the MC 1 R protein due to a premature stop codon (nonsense mutation), which results in a short peptide that has no activity. Changed amino acids (a missense mutation) in the MC 1 R protein, which results in a receptor with different activity. Missing amino acids in the MC 1 R protein, which results in a receptor with different activity. Less transcription of the MC 1 R gene, which means lighter color.
This figure shows the 8 amino acid deletion from the receptor. Use this figure to answer WQ 4: How might this deletion result in black color? Deletion of these amino acids actually causes the receptor to be more active, either by increasing binding to α-MSH, blocking ASIP binding, making the receptor signal “on” in the absence of ligand, or some combination of the three. Helen Mc. Robie et al. J Hered 2009; 100: 709 -714 © The American Genetic Association. 2009. All rights reserved. For permissions, please email: journals. permissions@oxfordjournals. org.
WQ 5: Punnett square • • • Now you’ve seen a specific example of how a relatively simple change in DNA can alter the phenotype of an organism. When you do genetics problems, Remember that squirrels are diploid, so each squirrel has two alleles for color. In this example, the potential alleles are “E+” for wt MC 1 R or “EB” for the 24 base deletion. We can consider EB as essentially dominant to E+ because squirrels with either one or two copies of EB display the melanistic phenotype. Technically, though, homozygotes are “jet-black” and heterozygotes are “brown-black. ”
Suppose a brown-black (E+EB) squirrel mates with a gray squirrel (E+E+). What are the odds of producing gray offspring? A. B. C. D. E. 1/4 3/16 1/2 3/4 All offspring will be gray (E+EB) X (E+E+)
Now that you know the biological mechanism responsible for black color, will this color will be selected for or against? Discuss. A. For B. Against C. Shut up, teach! It depends Answer WQ 6: Advantages and disadvantages
What do these data reveal about the black (“melanistic”) phenotype? A. Black squirrels only live in the cold B. Squirrel color has no relationship to temperature C. Gray squirrels can’t survive in the cold D. There is a correlation between lower temperature and more black squirrels in a population
Based on the previous data, which region of the map might have the highest population of black vs gray squirrels? A. B. C. D. A. B. C. D.
Black squirrels were introduced into the grey squirrel population in Britain 100 years ago, and have since spread to numerous localities. Which of the following would explain this pattern? A. Black coloration is selected for, because black squirrels stand out more than grey squirrels and are less likely to be killed by motorists. B. Black coloration is selectively neutral, because there are no natural predators of squirrels in urban areas. C. Black coloration is selected for, because black squirrels have lesser rate of heat loss in cold temperatures during the winter months. D. Black coloration is selected for, because squirrels find darker coloration more attractive. E. All of the above
Look back at your original flowchart. Complete WQ 7 by making a flowchart using specific details about squirrel color. Be sure to talk about selection for or against the trait.
The principles you’ve learned in discussing squirrel color apply broadly to any situation with variation and selection. You’ve probably heard of Human Immunodeficiency Virus, or HIV. One of the hallmarks of HIV is the enzyme reverse transcriptase (RT), which synthesizes DNA based using the viral RNA genome as a template. Because this enzyme isn’t a part of human biology, it is a logical target for antiretroviral therapy. The structure on the right shows how the drug nevirapine binds to RT. The red and green colored amino acids are sites where known mutations confer drug Fig. 6. Diagram showing the NNRTI site with the principle drug resistance mutation resistance. Think: how do these sites coloured either in green (crystal structures known) or red (structures not reported as yet). Residues where no mutations have been reported are coloured in blue. The mutations arise? NNRTI shown is nevirapine. Jingshan Ren, David K. Stammers Structural basis for drug resistance mechanisms for non-nucleoside inhibitors of HIV reverse transcriptase Virus Research, Volume 134, Issues 1– 2, 2008, 157– 170 http: //dx. doi. org/10. 1016/j. virusres. 2007. 12. 018
How do the drug resistance mutations described on the previous slide occur? A. Presence of a drug over time causes resistance mutations to occur. B. The mutations occur due to random chance during reverse transcription. C. As long as someone isn’t infected with a resistant strain, drug treatment will be effective. D. A and B E. All of the above
- Slides: 27