The polymerase chain reaction PCR Experiment Goals Understand

The polymerase chain reaction (PCR)

Experiment Goals • Understand how PCR technique works • Perform PCR experiment • Analyze PCR products

What is PCR? • Definition § The polymerase chain reaction (PCR) is a technique to amplify a piece of DNA very rapidly outside a living cell

Development of PCR § 1971: Khorana described basic principle of DNA replication using DNA primers § 1983: Dr. Karry Mullis developed PCR technique, for which he received the Nobel Prize in Chemistry in 1993.

PCR Applications • PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. • Structural analysis • DNA typing • Disease detection • Cloning • Mutation analysis • Detection of gene expression • Mapping • Site-directed mutagenesis • Sequencing • Forensic medicine • Scientific research • Pre-natal diagnosis

How does PCR work? • DNA is denatured (H-bonds are broken between strands of DNA with heat), 94 o. C • Primers attach to complementary sequences of single stranded DNA, 55 -60 o. C • DNA polymerase attaches to primer with ss. DNA and extends DNA fragment, 72 o. C • Thus, making double stranded DNA • This is done by changing the temperature

PCR Reaction Components 1) Target DNA - contains the sequence to be amplified. 2) Pair of Primers - oligonucleotides that define the sequence to be amplified. 3) d. NTPs - deoxynucleotidetriphosphates: DNA building blocks. 4) Thermostable DNA Polymerase - enzyme that catalyzes the reaction 5) Mg++ ions - cofactor of the enzyme 6) Buffer solution – maintains p. H and ionic strength of the reaction solution suitable for the activity of the enzyme

1) Target DNA § Target of DNA can be Ø a single gene Ø part of a gene Ø or a non-coding sequence

DNA Quality • DNA should be intact and free of contaminants that inhibit amplification. – Contaminants can be purified from the original DNA source. • Heme from blood, and melanin from hair – Contaminants can be introduced during the purification process. • Phenol, ethanol, sodium dodecyl sulfate (SDS) and other detergents, and salts.

DNA quantity • More template is not necessarily better. – Too much template can cause nonspecific amplification. – Too little template will result in little or no PCR product.

How Big A Target is? • Amplification products are typically in the size range 100 -1500 bp. • Longer targets are amplifiable >25 kb. • Requires modified reaction buffer, cocktails of polymerases, and longer extension times.

2) Pair of Primers • Primers define the DNA sequence to be amplified—they give the PCR specificity. • Primers bind (anneal) to the DNA template and act as starting points for the DNA polymerase, – DNA polymerases cannot initiate DNA synthesis without a primer. • The distance between the two primers determines the length of the newly synthesized DNA molecules.

3) d. NTPs (deoxynucleotidetriphosphates) – The building blocks for the newly synthesized DNA strands. – d. ATP, d. GTP, d. CTP or d. TTP

4) Thermostable DNA Polymerase • DNA Polymerase is the enzyme responsible for copying the sequence starting at the primer from the single DNA strand • Commonly use Taq, an enzyme from the hyperthermophilic organisms Thermus aquaticus, isolated first at a thermal spring • This enzyme is heat-tolerant – it is thermally tolerant (survives the melting T of DNA denaturation) – which also means the process is more specific, higher temps result in less mismatch – more specific replication

Running PCR • The PCR is commonly carried out in a reaction volume of 15 -100 μl in small reaction tubes (0. 2 -0. 5 ml volumes) in a thermal cycler. • The thermal cycler allows heating and cooling of the reaction tubes to control the temperature required at each reaction step. • Thin-walled reaction tubes permit favorable thermal conductivity to allow for rapid thermal equilibration. • Most thermal cyclers have heated lids to prevent condensation at the top of the reaction tube. • Older thermocyclers lacking a heated lid require a layer of oil on top of the reaction mixture or a ball of wax inside the tube.

Initialization step • Prior to the first cycle, there is an initialization step – the PCR reaction is often heated to a temperature of 94 -96°C, and this temperature is then held for 1 -9 minutes – This first hold is employed to ensure that most of the DNA template and primers are denatured, – Also, some PCR polymerases require this step for activation

PCR Reaction Cycles • One PCR cycle consists of a DNA denaturation step, a primer annealing step and a primer extension step. § § § DNA Denaturation: Expose the DNA template to high temperatures to separate the two DNA strands and allow access by DNA polymerase and PCR primers. Primer Annealing: Lower the temperature to allow primers to anneal to their complementary sequence. Primer Extension: Adjust the temperature for optimal thermostable DNA polymerase activity to extend primers.

PCR

PCR: First 4 Cycles

PCR: Completed Amplification Cycle

PCR: Completed Amplification Cycle § Each cycle: 1 copy of DNA template will give 2 copies from double-stranded DNA templates. § n cycles will give 2 n copies § Assuming a cycle lasts 6 min: § 1 double-stranded DNA molecule § 35 cycles § 34 x 109 copies in 3. 5 hrs! § There also ≈ 60 other DNA copies

Analyze PCR products • Check a sample by gel electrophoresis. • Is the product the size that you expected? • Is there more than one band? • Is any band the correct size? • May need to optimize the reaction conditions.

PCR Modifications • Nested PCR – increases the specificity of DNA amplification, by reducing background due to non-specific amplification of DNA. Two sets of primers are being used in two successive PCRs. • Multiplex PCR – The use of multiple, unique primer sets within a single PCR mixture to produce amplicons of varying sizes specific to different DNA sequences. • Reverse-transcriptase PCR – (Reverse Transcription PCR) is a method used to amplify, isolate or identify a known sequence from a cellular or tissue RNA. The PCR is preceded by a reaction using reverse transcriptase to convert RNA to c. DNA.

Polymerase Chain Reaction Controls for PCR • Blank reaction (Negative control reaction) – Controls for contamination – Contains all reagents except DNA template • Positive control reaction – Controls for sensitivity – Contains all reagents and a known target-containing DNA template

Contamination of PCR Reactions • Most common cause is carelessness and bad technique. • Separate pre- and post-PCR facilities. • Dedicated pipettes and reagents. • Change gloves. • Aerosol barrier pipette tips. • 10% bleach, UV light

Procedure 1 - Prepare master Mix 2 - Program thermocycler 3 - Run the samples on thermocycler 4 - Analysis of PCR products

Target DNA • Amplification of part of the Human growth hormone gene • Specific primers used • Forward primer: 5’TCCCTTCCCAACCATTCCCTTA-3’ • Reverse primer: 5’CCACTCACGGATTTCTGTTGTGTTTC 3’

1 - Master Mix PCR reaction mixture Reagent Volume (µl) Final concentration PCR buffer (X 10) 2. 0 10 m. M Mg. Cl 2 (25 m. M) 1. 6 2. 0 m. M d. NTPs (100 m. M) 0. 1 m. M Primer 1 (F) 0. 2 1. 0 µM Primer 2 (R) 0. 2 1. 0 µM Taq DNA polymerase 0. 25 2. 0 U DNA template 2. 0 100 ng Water 13. 7

2 - Program the Thermocycler Profile is: §Step 1: Denaturation for 3 min. at 95 o. C §Step 2: 35 cycles §Melting for 60 sec. at 95 o. C §Annealing for 60 sec. at 57 o. C §Extension for 90 sec. at 72 o. C §Step 3: Final elongation for 10 min. at 72 o. C

4 - Analysis of PCR products § Analyse products on 2% agarose gel containing ethidium bromide § Visualize the PCR product on UV transilluminator -ve +ve Sample