The Great Clade Race Treethinking activities for marine

  • Slides: 32
Download presentation
The Great Clade Race Tree-thinking activities for marine scientists Susan L. Richardson, Ph. D.

The Great Clade Race Tree-thinking activities for marine scientists Susan L. Richardson, Ph. D. Wilkes Honors College, Florida Atlantic University Teaching Oceanography Workshop: 18 -20 June 2013

Why Tree-thinking? • • Understanding how to interpret phylogenetic, or evolutionary trees, is an

Why Tree-thinking? • • Understanding how to interpret phylogenetic, or evolutionary trees, is an essential skill in modern biology. Trees are generated from computer analyses of morphological (phenotypic characters) and/or molecular sequence (DNA, RNA, etc. ) data sets. Phylogenetic tree of 3, 000 species: <1% of known species are depicted http: //www. utexas. edu/features/2008/tree/

Fish supper Mosses Cornflakes are here Animals You are here Athlete’s foot Plants Cotton

Fish supper Mosses Cornflakes are here Animals You are here Athlete’s foot Plants Cotton socks “Protists” Fungi Bacteria

Muséum nationale d’Histoire Naturelle (Paris)

Muséum nationale d’Histoire Naturelle (Paris)

Why Tree-thinking? Evolution underlies biological diversity • • • Most current biology textbooks portray

Why Tree-thinking? Evolution underlies biological diversity • • • Most current biology textbooks portray the evolutionary relationships of organisms in the form of phylogenetic trees. Life in modern oceans is more abundant and diverse than on land. Life evolved in the ocean and radiated to freshwater and terrestrial habitats. “Water” by Giuseppe Arcimboldo (1566)

Why Tree-thinking? Tree of Life

Why Tree-thinking? Tree of Life

Why Tree-thinking? Unculturable Marine Microbes • • Environmental sequencing of seawater has illuminated the

Why Tree-thinking? Unculturable Marine Microbes • • Environmental sequencing of seawater has illuminated the vast diversity of genes in the ocean. Some groups of marine microbes (and viruses) are only known from gene sequences. Craig Venter on Sorcerer II http: //ucsdnews. ucsd. edu/thisweek/2006/oct/10_16_venter. asp

Why Tree-thinking? Unculturable Marine Microbes • • • Some groups of marine microbes are

Why Tree-thinking? Unculturable Marine Microbes • • • Some groups of marine microbes are only known from gene sequences The SAR 11 clade is a group of alpha-proteobacteria identified primarily from ribosomal gene sequences identified in DNA extracted from seawater. The global biomass of SAR 11 bacteria is greater than all the fish in the ocean; their abundance is estimated to be 2. 4 X 1028 SAR 11 bacterial cells in ocean. Brown et al. (2012). Global biogeography of SAR 11 marine bacteria: Molecular Systems Biology, 8: 595.

Why Tree-thinking? Conservation Applications • Trees are used in marine conservation biology to identify

Why Tree-thinking? Conservation Applications • Trees are used in marine conservation biology to identify illegally harvested marine life. • • Legal: Minke whales; fin whales? Illegal: Humpback whales; dolphins er & Palumbi (1994). Which whales are hunted? A molecular genetic approach to monitoring whaling: Science, v. 265, p. 1538 -15

Why Tree-thinking? Conservation Applications • Witness for the Whales is a service for the

Why Tree-thinking? Conservation Applications • Witness for the Whales is a service for the identification of cetaceans (whales, dolphins and porpoises) using DNA sequences. http: //www. cebl. auckland. ac. nz: 9000/page/wftw/intro

Why Tree-thinking? Conservation Applications • Sequence 1 • >Unknown 1 • GAAAATATTGTACAATAACCACAAGGCCACAGTATTATGTCCGT ATTAAAAATAACTTATTGCATACTGTTATGTAACTTGTGCATGTACTCCCACATAACCCATAGTAGTATTCCCCTGTGAATATGTACACATACTATGTATAATTGTGCATTCAATTATCTTCACTACG GAAGTTAAAGCCCGTATTAAATTTTATTAATTTTACATAATAT

Why Tree-thinking? Conservation Applications • Sequence 1 • >Unknown 1 • GAAAATATTGTACAATAACCACAAGGCCACAGTATTATGTCCGT ATTAAAAATAACTTATTGCATACTGTTATGTAACTTGTGCATGTACTCCCACATAACCCATAGTAGTATTCCCCTGTGAATATGTACACATACTATGTATAATTGTGCATTCAATTATCTTCACTACG GAAGTTAAAGCCCGTATTAAATTTTATTAATTTTACATAATAT TTATTAATAGTACATGTTCTTATGCATCCTCAGGTCATTCT AGACGGAATGACTCTTATGGCCGCTCCATTAGATCACGAGCTTAATCA GCATGCCGCGTGAAACCAGCAACCCGCTCGGCAGGGATCCCTCTTC TCGCACCGGGCCCATCAATCGTGGGGGTAGCTATTTAATGATCTTTAT AAGACATCTGGTTCTTACTTCAGGACCATATTAACTTAAAATCGCCCA CTC http: //www. cebl. auckland. ac. nz: 9000/page/whales/title

http: //www. cebl. auc kland. ac. nz: 9000/pa ge/whales/title http: //www. cebl. auckland. ac.

http: //www. cebl. auc kland. ac. nz: 9000/pa ge/whales/title http: //www. cebl. auckland. ac. nz: 9000/page/wftw/methods ID’d as gray whale

Why Tree-thinking? Trees show evolutionary trends Lim et al. (2010). Phylogeny of hammerhead sharks

Why Tree-thinking? Trees show evolutionary trends Lim et al. (2010). Phylogeny of hammerhead sharks (Family Sphyrinidae) inferred from mitochondrial and nuclear genes. Mol. Phylog. & Evol. 55: 572 -579.

The Great Clade Race • These cards represent cards carried by eight runners in

The Great Clade Race • These cards represent cards carried by eight runners in an imaginary race through the woods. • The racecourse is made of diverging paths. As runners encounter a fork in the path, they choose to go to the right or the left, and continue in this manner to the finish line. • Although each runner starts the race at the same place, each runner finishes the race at a separate finish line. Goldsmith (2003). The Great Clade Race. American Biology Teacher 65(9): 679 -682.

The Great Clade Race • • • Along the stretches between the forks in

The Great Clade Race • • • Along the stretches between the forks in the path are check -in stations; each check-in station has a unique stamp. As runners pass a station, they stop to collect a stamp on their card. Using the collections of stamps on each card, students must reconstruct the pattern of the racecourse that shows: the forks in the path, the location of the check-in stations & the finish line for each runner.

The Great Clade Race Rules 1. All runners must complete the race. They cannot

The Great Clade Race Rules 1. All runners must complete the race. They cannot drop out of the race. 2. When the path branches, it only branches into two new paths, never three or more. 3. Once two paths have branched off from one another, they can never reconnect. 4. Check-in stations along the legs between the forks in the path.

Work in groups to map out the “racecourse” for the Great Clade Race.

Work in groups to map out the “racecourse” for the Great Clade Race.

The Great Clade Race Correct Trees • There are several correct trees that contain

The Great Clade Race Correct Trees • There are several correct trees that contain the same information. • • • The pattern of branching is what is relevant; branches can be rotated around each node and still portray the same information. Branch length is not important for our example. Shape (square, curved, etc. ) of trees is not important; orientation is not important.

The Great Clade Race One Correct Tree

The Great Clade Race One Correct Tree

The Great Clade Race Another Correct Tree

The Great Clade Race Another Correct Tree

Runners 1 -4 Alternative “tree” topologies

Runners 1 -4 Alternative “tree” topologies

Runners 1 -4 Alternative “tree” topologies

Runners 1 -4 Alternative “tree” topologies

Runners 5 -8 Alternative “tree” topologies

Runners 5 -8 Alternative “tree” topologies

Examples of Student Trees

Examples of Student Trees