The Gateway Cloning System Cloning multiple fragments into

The Gateway® Cloning System Cloning multiple fragments into a single vector Contents • How to clone up to 4 DNA fragments simultaneously into one destination vector. • Examples of expression of multiple genes in He. La cells. • Example of testing the effects of promoters and regulatory elements on protein expression.

Multi. Site Gateway® - Extending the applications PCR Your Source Library ORF collection Gene synthesis Gene Protein Localization Your Application Gene Entry Clone Gene Protein Purification RNAi Gene Cell-Free Protein interaction Gene 1 Gene 2 Gene 3 Gene 4 Your Application 2 Invitrogen Proprietary & Confidential

Sample Applications · Optimized multigene delivery without co-transfection · Expression of enzymatic pathways · Expression of multi-subunit protein complexes · Gene knock-down and rescue (controllable RNAi and heterologous gene expression from the same construct) 3 · Variable gene expression levels using different expression elements · Combinatorial tagging Invitrogen Proprietary & Confidential

More att sequences needed Standard Gateway® 4 CTGCTTTTTTGTACAAACTTG att. B 1 CAGCTTTCTTGTACAAAGTTG att. B 2 CAACTTTATTATACAAAGTTG att. B 3 CAACTTTTCTATACAAAGTTG att. B 4 CAACTTTTGTATACAAAGTTG att. B 5 Multi. Site Gateway® Invitrogen Proprietary & Confidential

2 -fragment Multi. Site Gateway® Pro PCR Fragments p. DONRs att. B 1 att. B 5 r att. B 5 att. B 2 X X att. P 1 att. P 5 r att. P 5 att. P 2 BP reactions att. L 5 Entry Clones att. L 2 X att. L 1 att. R 5 X Destination Vectors att. R 1 att. R 2 LR reaction Expression clones 5 att. B 1 att. B 5 att. B 2 Invitrogen Proprietary & Confidential

3 -fragment Multi. Site Gateway® Pro PCR Fragments p. DONRs att. B 1 att. B 4 r att. B 3 att. B 2 X X X att. P 1 att. P 4 r att. P 3 att. P 2 BP reactions Entry clones Destination vector att. L 1 att. R 1 att. L 4 att. L 3 X X att. R 4 att. R 3 Cm. R ccd. B att. L 2 att. R 2 LR reaction Expression clone 6 att. B 1 att. B 4 att. B 3 att. B 2 Invitrogen Proprietary & Confidential

4 -fragment Multi. Site Gateway® Pro PCR Fragments att. B 1 p. DONRs att. P 1 X att. B 5 r att. B 5 X att. P 5 r att. B 4 r att. B 3 r X X att. P 5 att. P 4 r att. P 3 r att. L 5 Entry Clones att. L 1 att. L 4 att. L 3 X X X att. R 5 att. R 4 att. R 3 att. L 2 att. B 3 att. B 2 X X att. P 3 att. P 2 BP reactions X Destination Vectors att. R 1 att. R 2 LR reaction Expression clones 7 att. B 1 att. B 5 att. B 4 att. B 3 att. B 2 Invitrogen Proprietary & Confidential

Multi. Site Gateway® Three-Fragment Vector Construction Kit PCR Fragments p. DONRs att. B 4 att. B 1 r att. B 1 att. B 2 r att. B 3 X X X att. P 4 att. P 1 r att. P 1 att. P 2 r att. P 3 BP reactions Entry clones Destination vector att. L 4 att. R 1 att. R 2 X X att. L 1 att. L 2 Cm. R ccd. B att. L 3 att. R 3 LR reaction Expression clone 8 att. B 4 att. B 1 att. B 2 att. B 3 Invitrogen Proprietary & Confidential

Typical Results Number of recombining fragments 9 Expected # colonies per 10 L reaction Typical recombination efficiency (%) 1 103 -106 90 -100 2 103 -105 80 -100 3 103 -104 70 -90 4 102 -103 30 -80 Invitrogen Proprietary & Confidential

In silico cloning using Vector NTI Advance. TM 10. 3 DNA of interest Primers for PCR reaction Cloning Strategy 10 Invitrogen Proprietary & Confidential

Shortcomings when co-transfecting two plasmids EGFP m. RFP PCAG EGFP m. RFP Plasmid 1 m. RFP Plasmid 2 Courtesy of Dr. Imamoto, Osaka University, Japan 11 Invitrogen Proprietary & Confidential

Example: Expression of Multiple Genes in Human Cells CFP A B 12 p. CMV B 1 p. CMV B 5 B 4 p. EF 1 a B 3 YFP B 4 p. EF 1 a B 3 CFP YFP B 2 Invitrogen Proprietary & Confidential

Rapid Testing of Expression Elements using Multi. Site Gateway® Kozak or Promoter IRES EGFP p. ABGH He. La aurora A cdc 2 cyclin B 1 cyclin E CMV EF 1 -a ( CAG ) ( SV 40 ) Kozak or Gtx 2 x. Gtx 5 x. Gtx 12 x. Gtx EMCV m. HCV 2 a m. HCV 33 m. HCV 45 HCV 2 a HCV 33 HCV 45 Determination of expression level of EGFP IRES ( Internal Ribosome Entry Site ) Courtesy of Dr. Imamoto, Osaka University, Japan 13 Invitrogen Proprietary & Confidential

Rapid Testing of Expression Elements using Multi. Site Gateway® Promoter Kozak or IRES EGFP p. A He. La Transcriptional signals with Kozak 40. 0 35. 0 300 29 30. 0 250 10. 0 50 5. 0 1 1 5 x. Gtx 2 x. Gtx Kozak None EF 1 -a CMV cdc 2 aurora A cyclin E 0. 0 0 9 4 7 7 m. HCV 45 100 13 13 EMCV 15. 0 12 x. Gtx 150 m. HCV 2 a 20. 0 m. HCV 33 25. 0 200 cyclin B 1 Relative activity Translational signals with CMV promoter Courtesy of Dr. Imamoto, Osaka University, Japan 14 Invitrogen Proprietary & Confidential

Summary for Multi. Site Gateway® Technology Multi. Site Gateway® Three. Fragment Vector Construction Kit Compatible with… · Ultimate™ ORF clones Multi. Site Gateway® Pro · att. L 1 -att. L 2 entry clones · Multi. Site Gateway® Pro entry clones · att. R 4 -att. R 3 DEST vectors · att. R 1 -att. R 2 DEST vectors Available for… · Only 3 -fragment cloning · 2 -, 3 -, or 4 -fragment cloning Applications · Vector construction · Promoter analysis · Expression of multiple genes in one plasmid · Reporter analysis …and more 15 Invitrogen Proprietary & Confidential