The EGFR Signaling Pathway EGF n Epidermal Growth

  • Slides: 20
Download presentation
+ The EGFR Signaling Pathway

+ The EGFR Signaling Pathway

+ EGF n Epidermal Growth Factor (EGF) n Binds to Epidermal Growth Factor Receptor

+ EGF n Epidermal Growth Factor (EGF) n Binds to Epidermal Growth Factor Receptor (EGFR) n Results in n n Cell Growth n Cell Proliferation n Cell Differentiation Controls through the EGFR signaling pathway

+ Mouse EGF From Wikipedia

+ Mouse EGF From Wikipedia

+ The EGFR Signaling Pathway Overview

+ The EGFR Signaling Pathway Overview

+ The EGFR Signaling Pathway Overview n Binds to EGF n Controls: n signaling

+ The EGFR Signaling Pathway Overview n Binds to EGF n Controls: n signaling adapter proteins: accessory proteins, lack intrinsic enzymatic activity, mediate specific protein-protein interactions that drive the formation of protein complexes n Grb 2 n Shc n Enzyme PLCΥ n Guanine nucleotide exchange factor: Sos

+ The EGFR Signaling Pathway Binding of EGF n n Molecules n EGF n

+ The EGFR Signaling Pathway Binding of EGF n n Molecules n EGF n R: Unbounded EGFR n Ra: Bounded EGFR n R 2: Dimeric EGFR Reactions 1. EGF binds to monomeric EGFR 2. EGF-bounded EGFRs dimerize

+ The EGFR Signaling Pathway Binding of EGF # Ligand-receptor binding egfr(l, r) +

+ The EGFR Signaling Pathway Binding of EGF # Ligand-receptor binding egfr(l, r) + egf(r) <-> egfr(l!1, r). egf(r!1) kp 1, km 1 # Receptor-aggregation egfr(l!1, r) + egfr(l!2, r) <-> egfr(l!1, r!3). egfr(l!2, r!3) kp 2, km 2

+ The EGFR Signaling Pathway Transphorylation of EGFR n n Molecules n R 2:

+ The EGFR Signaling Pathway Transphorylation of EGFR n n Molecules n R 2: Dimeric EGFR n RP: Transphorylated EGFR Reactions 3. Dimeric EGFR transphorylation 4. Dimeric EGFR dephosphorylation

+ The EGFR Signaling Pathway Transphorylation of EGFR # Transphorylation of egfr(r!1, Y 1068~Y)

+ The EGFR Signaling Pathway Transphorylation of EGFR # Transphorylation of egfr(r!1, Y 1068~Y) -> egfr(r!1, Y 1068~p. Y) kp 3 egfr(r!1, Y 1148~Y) -> egfr(r!1, Y 1148~p. Y) kp 3 #Dephosphorylayion egfr(Y 1068~p. Y) -> egfr(Y 1068~Y) km 3 egfr(Y 1148~p. Y) -> egfr(Y 1148~Y) km 3

+ The EGFR Signaling Pathway Binding of PLCγ n Not Included in the BNGL

+ The EGFR Signaling Pathway Binding of PLCγ n Not Included in the BNGL File n Molecules n n PLCΥP: Phosphorylated PLCΥ n RP: EGFR transphorylated at Y 992 Reactions 5. Binding of PLCΥ 6. Phosphorylation of PLCΥ 7. Binding of PLCΥP to RP at Y 992

+ The EGFR Signaling Pathway Binding of Grb 2 n n Molecules n Grb

+ The EGFR Signaling Pathway Binding of Grb 2 n n Molecules n Grb 2 n RP: EGFR transphorylated at Y 1068 Reactions 9. Binding of Grb 2 to RP at Y 1068 10. Binding of Sos to p. Y 1068 -Grb 2 11. Binding of PLCΥP to RP at 1068

+ The EGFR Signaling Pathway Binding of Grb 2 # Y 1068 activity egfr(Y

+ The EGFR Signaling Pathway Binding of Grb 2 # Y 1068 activity egfr(Y 1068~p. Y) + Grb 2(SH 2, SH 3) <-> egfr(Y 1068~p. Y!1). Grb 2(SH 2!1, SH 3) kp 9, km 9 egfr(Y 1068~p. Y) + Grb 2(SH 2, SH 3!2) <-> egfr(Y 1068~p. Y!1). Grb 2(SH 2!1, SH 3!2) kp 11, km 11 egfr(Y 1068~p. Y!1). Grb 2(SH 2!1, SH 3) + Sos(dom) <-> egfr(Y 1068~p. Y!1). Grb 2(SH 2!1, SH 3!2). Sos(dom!2) kp 10, km 10

+ The EGFR Signaling Pathway Binding of Shc n Molecules n Shc. P: Phosphorylated

+ The EGFR Signaling Pathway Binding of Shc n Molecules n Shc. P: Phosphorylated Shc n RP: EGFR transphorylated at Y 1148/74 n Reactions 13. Binding of Shc to p. Y 1148/74 14. Phosphorylation of Shc 15. Binding of Shc. P to p. Y 1148/74 17. Binding of Grb 2 to p. Y 1148/74 Shc. P

+ The EGFR Signaling Pathway Binding of Shc # Rule 13 egfr(Y 1148~p. Y)

+ The EGFR Signaling Pathway Binding of Shc # Rule 13 egfr(Y 1148~p. Y) + Shc(PTB, Y 317~Y) <-> egfr(Y 1148~p. Y!1). Shc(PTB!1, Y 317~Y) kp 13, km 13 # Rule 14 egfr(r!2, Y 1148~p. Y!1). Shc(PTB!1, Y 317~Y) -> egfr(r!2, Y 1148~p. Y!1). Shc(PTB!1, Y 317~p. Y) kp 14 # Rule 15 egfr(Y 1148~p. Y) + Shc(PTB, Y 317~p. Y) <-> egfr(Y 1148~p. Y!1). Shc(PTB!1, Y 317~p. Y) kp 15, km 15 # Rule 17 egfr(Y 1148~p. Y!1). Shc(PTB!1, Y 317~p. Y) + Grb 2(SH 2, SH 3) <-> egfr(Y 1148~p. Y!1). Shc(PTB!1, Y 317~p. Y!2). Grb 2(SH 2!2, SH 3) kp 17, km 17

+ The EGFR Signaling Pathway Binding of Shc n Reactions 18. Binding of Shc.

+ The EGFR Signaling Pathway Binding of Shc n Reactions 18. Binding of Shc. P-Grb 2 to p. Y 1148/74 19. Binding of Sos to p. Y 1148/74 -Shc. P -Grb 2 20. Binding of Shc. P-Grb 2 -Sos to p. Y 1148/74 24. Binding of Grb 2 -Sos to p. Y 1148/74 -Shc. P

+ The EGFR Signaling Pathway Binding of Shc # Rule 18 egfr(Y 1148~p. Y)

+ The EGFR Signaling Pathway Binding of Shc # Rule 18 egfr(Y 1148~p. Y) + Shc(PTB, Y 317~p. Y!1). Grb 2(SH 2!1, SH 3) <-> egfr(Y 1148~p. Y!2). Shc(PTB!2, Y 317~p. Y!1). Grb 2(SH 2!1, SH 3) kp 18, km 18 # Rule 19, note the pattern matching here Shc(PTB!1, Y 317~p. Y!2). Grb 2(SH 2!2, SH 3) + Sos(dom) <-> Shc(PTB!1, Y 317~p. Y!2). Grb 2(SH 2!2, SH 3!3). Sos(dom!3) kp 19, km 19 # Rule 20 egfr(Y 1148~p. Y) + Shc(PTB, Y 317~p. Y!1). Grb 2(SH 2!1, SH 3!3). Sos(dom!3) <-> egfr(Y 1148~p. Y!2). Shc(PTB!2, Y 317~p. Y!1). Grb 2(SH 2!1, SH 3!3). Sos(dom!3) kp 20, km 20 # Rule 24 egfr(Y 1148~p. Y!1). Shc(PTB!1, Y 317~p. Y) + Grb 2(SH 2, SH 3!3). Sos(dom!3) <-> egfr(Y 1148~p. Y!1). Shc(PTB!1, Y 317~p. Y!2). Grb 2(SH 2!2, SH 3!3). Sos(dom!3) kp 24, km 24

+ The EGFR Signaling Pathway Cytosolic Reactions without EGFR n Reactions 12. Binding of

+ The EGFR Signaling Pathway Cytosolic Reactions without EGFR n Reactions 12. Binding of Grb 2 and Sos 23. Binding of Grb 2 -Sos to Shc. P 22. Binding of Shc. P-Grb 2 to Sos 21. Binding of Shc. P and Grb 2 16. Dephoshporylation of Shc. P 8. Dephoshphorylation of PLCΥ(Not Included) 25. Inactivation of PLCΥP (Not Included)

+ The EGFR Signaling Pathway Cytosolic Reactions without EGFR # Rule 12 Grb 2(SH

+ The EGFR Signaling Pathway Cytosolic Reactions without EGFR # Rule 12 Grb 2(SH 2, SH 3) + Sos(dom) <-> Grb 2(SH 2, SH 3!1). Sos(dom!1) kp 12, km 12 # Rule 23 Shc(PTB, Y 317~p. Y) + Grb 2(SH 2, SH 3!2) <-> Shc(PTB, Y 317~p. Y!1). Grb 2(SH 2!1, SH 3!2) kp 23, km 23 # Rule 22 Shc(PTB, Y 317~p. Y!2). Grb 2(SH 2!2, SH 3) + Sos(dom) <-> Shc(PTB, Y 317~p. Y!2). Grb 2(SH 2!2, SH 3!3). Sos(dom!3) kp 22, km 22 # Rule 21 Shc(PTB, Y 317~p. Y) + Grb 2(SH 2, SH 3) <-> Shc(PTB, Y 317~p. Y!1). Grb 2(SH 2!1, SH 3) # Rule 16 Shc(PTB, Y 317~p. Y) -> Shc(PTB, Y 317~Y) km 16 kp 21, km 21

+ The EGFR Signaling Pathway Putting all together

+ The EGFR Signaling Pathway Putting all together

+ The END Thank You! 20

+ The END Thank You! 20

Epidermal growth factor EGF promotes ovarian steroidogenesis andEpidermal growth factor EGF promotes ovarian steroidogenesis and
Sitespecific OGlucosylation of the Epidermal Growth Factorlike EGFSitespecific OGlucosylation of the Epidermal Growth Factorlike EGF
IPASS EGFR wildtype EGFR mutationpositive Gefitinib n132 CarboplatinpaclitaxelIPASS EGFR wildtype EGFR mutationpositive Gefitinib n132 Carboplatinpaclitaxel
EGFR AP 2 EGFR agtgctgggaacgcccctctcggaaattaactcctcagggcacccgctcccatgcgccgccccactcc cgccggagactaggtcccgcgggggccaccgctgtccaccgcctccgg CGgccgctggccttgggtccccgct gctggttctcctcctcgcattctcctctgctcctcccgatccctcctccgccgcctggtcEGFR AP 2 EGFR agtgctgggaacgcccctctcggaaattaactcctcagggcacccgctcccatgcgccgccccactcc…
Epidermal Derivatives pg 6 Epidermal Derivatives pg 6Epidermal Derivatives pg 6 Epidermal Derivatives pg 6
Interdependency of EGF and GLP2 Signaling in AttenuatingInterdependency of EGF and GLP2 Signaling in Attenuating
Neurotrophin Signaling Trk Signaling Pathway Neurotrophins The neurotrophinsNeurotrophin Signaling Trk Signaling Pathway Neurotrophins The neurotrophins
Intrinsic pathway Extrinsic pathway Common pathway thombosis ThomboembolusIntrinsic pathway Extrinsic pathway Common pathway thombosis Thomboembolus
Augmentation of Staphylococcal Toxin Signaling by the EpidermalAugmentation of Staphylococcal Toxin Signaling by the Epidermal
Urinary Epidermal Growth Factor as a Marker ofUrinary Epidermal Growth Factor as a Marker of
Cysteine Substitutions in Epidermal Growth FactorLike Domains ofCysteine Substitutions in Epidermal Growth FactorLike Domains of
Epidermal Growth Factor Receptor MutationPositive NonSmallCell Lung CancerEpidermal Growth Factor Receptor MutationPositive NonSmallCell Lung Cancer
Specific Inhibitors of PlateletDerived Growth Factor or EpidermalSpecific Inhibitors of PlateletDerived Growth Factor or Epidermal
Easyef Ointment Recombinant Human Epidermal Growth Factor EasyefEasyef Ointment Recombinant Human Epidermal Growth Factor Easyef
Tissue remodeling induced by hypersecreted epidermal growth factorTissue remodeling induced by hypersecreted epidermal growth factor
Easyef Spray Recombinant Human Epidermal Growth Factor EasyefEasyef Spray Recombinant Human Epidermal Growth Factor Easyef
Epidermal Growth Factor Receptor Mutations and Prognosis inEpidermal Growth Factor Receptor Mutations and Prognosis in
Defining Epidermal Growth Factor Receptor exon 20 mutantDefining Epidermal Growth Factor Receptor exon 20 mutant
Mechanistic Insights into Oncogenic Activation of Epidermal GrowthMechanistic Insights into Oncogenic Activation of Epidermal Growth