The Basics of Genetics The Basics of Genetics
The Basics of Genetics
The Basics of Genetics • Inside every cell of each living thing (plant or animal) are sets of instructions called genes. • Genes provide the instructions on every feature of the organism: – what it looks like – how it is to behave – how it will respond to its surrounding environment.
• The genes are made of long stands of material called deoxyribonucleic acid (DNA) and then many genes are strung together to form chromosomes. • Most organisms have two pairs of chromosomes (one from each parent) • However the total number of chromosomes can vary from organism to organism. – For example, humans have 23 pairs of chromosomes and the fruit fly has 4 pairs.
• Each gene is made up of long combinations of four different nucleotide bases. • Like language, it is the number and order of the nucleotide bases that determine what the gene says about the organism. The four nucleotides are called: – Adenosine (A) – Thymine (T) – Guanosine (G) – Cytosine (C)
• The gene for green eyes might have this nucleotide sequence. – “AAACCGGTTTTTAACGTTATGGGCAAACGCGCGTTT AGTGAGACAAATTAACCGAGTTTAGATTCCCCAAATT GAGTTAACATGA” • The gene for blue eyes might have this nucleotide sequence. – “AAACCGGTTTTTAACGTTATGGGCAGACGCGCGTTT AGTGAGACAAATTAACCGAGTTTAGATTCCCCAAATT GAGTTAACATGA” • Notice how the nucleotide sequences are very similar.
• They both determine the eye colour characteristic, but the difference of only one nucleotide base results in a different colour. • If you have a copy of both genes, how does the body determine which colour your eyes will be? • Many genes have a quality known as dominance or recessiveness. Only the dominant gene will be expressed.
- Slides: 9