Telomeromics Jong Bhak UNIST jongbhakgmail com 3 D

Telomeromics Jong Bhak UNIST jongbhak@gmail. com

3 D structure of telomere

Telomere • A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes.

Word origin • Its name is derived from the Greek nouns telos (τέλος) 'end' and merοs (μέρος, root: μερ-) 'part. '

Telomere sequence in vertebrates • For vertebrates, the sequence of nucleotides in telomeres is TTAGGG. • This sequence of TTAGGG is repeated approximately 2, 500 times in humans. Sadava, D. , Hillis, D. , Heller, C. , & Berenbaum, M. (2011). Life: The science of biology. (9 th ed. ) Sunderland, MA: Sinauer Associates Inc.

Some known telomere nucleotide sequences Group Organism Telomeric repeat (5' to 3' toward the end) Vertebrates Human, mouse, Xenopus TTAGGG Filamentous fungi Neurospora crassa TTAGGG Physarum, Didymium TTAGGG Dictyostelium AG(1 -8) Trypanosoma, Crithidia TTAGGG Tetrahymena, Glaucoma TTGGGG Paramecium TTGGG(T/G) Oxytricha, Stylonychia, Euplotes TTTTGGGG Plasmodium TTAGGG(T/C) Arabidopsis thaliana TTTAGGG Cestrum elegans TTTTTTAGGG[41] Green algae Chlamydomonas TTTTAGGG Insects Bombyx mori TTAGG Roundworms Ascaris lumbricoides TTAGGC Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1 -8) Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template) or G(2 -3)(TG)(1 -6)T (consensus) Saccharomyces castellii TCTGGGTG Candida glabrata GGGGTCTGGGTGCTG Candida albicans GGTGTACGGATGTCTAACTTCTT Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT Candida maltosa GGTGTACGGATGCAGACTCGCTT Candida guillermondii GGTGTAC Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT Slime moulds Kinetoplastid protozoa Ciliate protozoa Apicomplexan protozoa Higher plants Budding yeasts

Telomere shortening • During chromosome replication, the enzymes that duplicate DNA cannot continue their duplication all the way to the end of a chromosome, so in each duplication the end of the chromosome is shortened.

End replication problem • This is because the synthesis of Okazaki fragments requires RNA primers attaching ahead on the lagging strand. • https: //www. youtube. com/watch? v=AJNo. Tm. Ws. E 0 s • https: //www. youtube. com/watch? v=Mjf. IWzufq_I

Buffer for chromosome • The telomeres are disposable buffers at the ends of chromosomes which are truncated during cell division; their presence protects the genesbefore them on the chromosome from being truncated instead.

Telomerase • Over time, due to each cell division, the telomere ends become shorter. • They are replenished by an enzyme, telomerase reverse transcriptase.

Discovery of telomere (Alexei Olovnikov) • In the early 1970 s, Russian theorist Alexei Olovnikov first recognized that chromosomes could not completely replicate their ends. Building on this, and to accommodate Leonard Hayflick's idea of limited somatic cell division, Olovnikov suggested that DNA sequences are lost every time a cell/DNA replicates until the loss reaches a critical level, at which point cell division ends. [4][5] • Olovnikov's prediction was not widely known except by a handful of researchers studying cellular aging and immortalization. [6]

Elizabeth Blackburn • In 1975– 1977, Elizabeth Blackburn, working as a postdoctoral fellow at Yale University with Joseph Gall, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends. [7]

Nobel Prize in Physiology or Medicine • Blackburn, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize in Physiology or Medicine for the discovery of how chromosomes are protected by telomeres and the enzyme telomerase. [8]

Geron • Nevertheless, in the 1970 s there was no recognition that the telomere-shortening mechanism normally limits cells to a fixed number of divisions, and no animal study suggesting that this could be responsible for aging on the cellular level and sets a limit on lifespans. [9][10] • It remained for a privately funded collaboration from biotechnology company Geron to isolate the genes for the RNA and protein component of human telomerase in order to establish the role of telomere shortening in cellular aging and telomerase reactivation in cell immortalization. [11]

Prokaryotes • Most prokaryotes, lacking this linear chromosomes, do not have telomeres. • Telomeres compensate for incomplete semi-conservative DNA replication at chromosomal ends. • A small fraction of bacterial chromosomes (such as those in Streptomyces, Agrobacterium, and. Borrelia) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions.

Shelterin • A protein complex known as shelterin serves as protection against double-strand break (DSB) repair by homologous recombination (HR) and non-homologous end joining (NHEJ). [12][13]

DNA polymerase • While replicating DNA, the eukaryotic DNA replication enzymes (the DNA polymerase protein complex) cannot replicate the sequences present at the ends of the chromosomes (or more precisely the chromatid fibres).

Telomere length variation • Telomere length varies greatly between species, from approximately 300 base pairs in yeast[16] to many kilobases in humans, and usually is composed of arrays of guanine-rich, six- to eight-base-pair-long repeats. • Species life-span vs telomere length

Cell Rep. 2012 Dec 27; 2(6): 1530 -6. doi: 10. 1016/j. celrep. 2012. 11. 021. Telomere length correlates with life span of dog breeds. • Telomeric DNA repeats are lost as normal somatic cells replicate. When telomeres reach a critically short length, a DNA damage signal is initiated, inducing cell senescence. Some studies have indicated that telomere length correlates with mortality, suggesting that telomere length contributes to human life span; • however, other studies report no correlation, and thus the issue remains controversial. • Domestic dogs show parallels in telomere biology to humans, with similar telomere length, telomere attrition, and absence of somatic cell telomerase activity. Using this model, we find that peripheral blood mononuclear cell (PBMC) telomere length is a strong predictor of average life span among 15 different breeds (p < 0. 0001), consistent with telomeres playing a role in life span determination. Dogs lose telomeric DNA ~10 -fold faster than humans, which is similar to the ratio of average life spans between these species. Breeds with shorter mean telomere lengths show an increased probability of death from cardiovascular disease, which was previously correlated with short telomere length in humans.

Telomere too short? • If telomeres become too short, they have the potential to unfold from their presumed closed structure. • The cell may detect this uncapping as DNA damage and then either stop growing, enter cellular old age (senescence), or begin programmed cell self-destruction (apoptosis) depending on the cell's genetic background (p 53 status).