Taha A KassHout MD MS FDA Chief Health
- Slides: 33
Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics Officer Director, FDA’s Office of Health Informatics David Litwack, Ph. D Policy Advisor FDA’s Center for Devices and Radiological Health Elaine R. Johanson Deputy, FDA Chief Health Informatics Officer Deputy Director, FDA’s Office of Health Informatics Joint work with many colleagues at FDA precision. fda. gov | precision. FDA@fda. hhs. gov | @precision. FDA
Genetic test (upstream) (downstream) Clinician orders test/services for patient, collects sample Clinician discusses outcome with patient NGS-based Genetic Test (end-to-end product) + Sample preparation and sequencing Core processing (Mapping, Variation Calling) Special processing (Annotation, Filtering, Interpretation)
Initial Focus Genotype Location 9: C → G mutation. . . Predicted Outcome " You are at risk for X outcome. " File with variants (VCF) Report Analytical Benchmark Clinical Benchmark
Initial Focus – Analytic Benchmarking • Assess reproducibility of a test • Assess accuracy using reference samples • Assess agreement with other methods • Assess test performance on synthetic data
Features Private or community areas Data Apps Comparisons Notes
https: //github. com/FDA
>930 members from >450 organizations
precision. fda. gov
Thank You! precision. fda. gov | precision. FDA@fda. hhs. gov | @precision. FDA
Backup Slides precision. fda. gov | precision. FDA@fda. hhs. gov | @precision. FDA
DNA Gene … AGCATCGATGCAGAAGATTACAAGACGATCCGCTC …
We are all unique … AGCATCGATGCAGAAGATTACAACATAAAAAGATTACACGCGATCCGCTC … reference … AGCATCGATGCATAAGATTACAAGATAAAAAGATTACACGCGATCCGCTC … David … AGCATCGATGCATAAGATTACAACATAAAAAGATTACATGCGATCCGCTC … Taha … AGCATCGCTGCAGAAGATTACAACATAAAAAGATTACATGCGATCCGCTC … Elaine
The Internet Cloud
Community Assurance
Add new Feature (Discussion) New Feature
- Lesson 3 commander in chief and chief diplomat
- Haithem taha
- Taha kass-hout
- Taha hussein challenges
- Taha havakhor
- Operations research taha
- Mahmud muhammed taha
- Sharif taha
- Sharif taha
- I accept
- Synapse
- Taha kass-hout
- Taha kass-hout
- Early feasibility study
- Nicole gillette fda
- Leonard sacks fda
- Real world evidence
- Equipment validation definition
- Hipoperfusion placentaria
- Fda v brown and williamson
- Klasyfikacja fda leki
- Institut sremska kamenica kardiologija
- Investigator's brochure
- Alma iris
- Fda gmp training
- Leonard sacks fda
- Nicole ibrahim fda
- Fda
- Fda chemist
- Efs program
- Fda oimt
- Fda ora org chart
- Michael marcarelli
- Fda reviewer jobs