Synthetic Biology Lecture 1 Introduction to Synthetic Biology
Synthetic Biology Lecture 1: Introduction to Synthetic Biology
What is Synthetic Biology? • Genetic Manipulation? • Genetic selection carried out for millenia (domestication of animals) • Mendelian selection ‘rationalized’ process. • Recombinant DNA
Engineering Goal: To build components that can be reliably and predictably assembled into ever more complicated systems
Fumbling Around • Current Systems are “Art”
Recombinant DNA
Genetic Tools
Scissors
Glue
Vectors
Synthesizing DNA
These are Tools, but…
We want to create complex systems
EE in the beginning
How useful is Maxwell?
Abstraction Works for E&M
Composability • OK - suppose we have individual parts that work, can we actually put them together such that they work in a welldefined/predictable way?
Standardization • Assembly • Part “Definition” • Interactions – Load – Input/Output – Stability
Standardizing a “Part” • Bio. Brick - standard ends, restrictions on internal sequence
Standard Assembly
Standard Assembly
Now we can share!
What constitutes a part? • The DNA Sequence? • The function?
Parts: Basic biological functions encoded as DNA
DNA Sequence • TAATACGACTCACTATAGGGAGA (T 7 promoter)
Load: Imposing on our Hosts • Parts don’t exist in a vacuum. • Cells may dislike the parts, resulting in mutation or rejection • Too much modification may result in cells that just give up and die
Standard Measurement
Our Parts aren’t necessarily Stable • Anything that adds load to a cell reduces its fitness vs. cells that ‘lose’ the part – Mutations: Losing a plasmid, alteration of promoters to not work as efficiently (or not at all) – Antibiotic resistance, dependence
Application Goals • Bacterial robotics • Microbial factories • Adding features to plants to reduce environmental requirements/impact
Cancer Destroying Robot
Adding Computation to Cells
Bacterial Communication Networks
Artemisinin
Public Policy http: //www. repeatfanzine. co. uk/Images/Impage/no%20 gmo. jpg
Is the fear so Irrational? • We claim we can make all sorts of cool things, why not something ‘evil’?
Major Risks
What is different now? • • • Rapid Sequencing Lots of sequence data on the internet Protocols available online Fedex Synthesis Data on Pathogens?
The good news Major weaponized biological agents have existed for decades Virulence, resistance, transmissibility were all enhanced prior to SB. The major advantage of our approach is putting together well characterized components. Creating new pathogens would require a full scale research effort
Summary • Engineering instead of Science • Modularity and Abstraction are powerful techniques • Mechanical Engineering, Electrical Engineering were all at the stage where it was “too complicated”.
- Slides: 43