Synthetic Biology Lecture 1 Introduction to Synthetic Biology

Synthetic Biology Lecture 1: Introduction to Synthetic Biology

What is Synthetic Biology? • Genetic Manipulation? • Genetic selection carried out for millenia (domestication of animals) • Mendelian selection ‘rationalized’ process. • Recombinant DNA

Engineering Goal: To build components that can be reliably and predictably assembled into ever more complicated systems

Fumbling Around • Current Systems are “Art”

Recombinant DNA

Genetic Tools

Scissors

Glue

Vectors

Synthesizing DNA

These are Tools, but…

We want to create complex systems

EE in the beginning

How useful is Maxwell?

Abstraction Works for E&M

Composability • OK - suppose we have individual parts that work, can we actually put them together such that they work in a welldefined/predictable way?

Standardization • Assembly • Part “Definition” • Interactions – Load – Input/Output – Stability

Standardizing a “Part” • Bio. Brick - standard ends, restrictions on internal sequence

Standard Assembly

Standard Assembly

Now we can share!

What constitutes a part? • The DNA Sequence? • The function?

Parts: Basic biological functions encoded as DNA

DNA Sequence • TAATACGACTCACTATAGGGAGA (T 7 promoter)

Load: Imposing on our Hosts • Parts don’t exist in a vacuum. • Cells may dislike the parts, resulting in mutation or rejection • Too much modification may result in cells that just give up and die

Standard Measurement

Our Parts aren’t necessarily Stable • Anything that adds load to a cell reduces its fitness vs. cells that ‘lose’ the part – Mutations: Losing a plasmid, alteration of promoters to not work as efficiently (or not at all) – Antibiotic resistance, dependence

Application Goals • Bacterial robotics • Microbial factories • Adding features to plants to reduce environmental requirements/impact

Cancer Destroying Robot

Adding Computation to Cells

Bacterial Communication Networks

Artemisinin

Public Policy http: //www. repeatfanzine. co. uk/Images/Impage/no%20 gmo. jpg

Is the fear so Irrational? • We claim we can make all sorts of cool things, why not something ‘evil’?

Major Risks

What is different now? • • • Rapid Sequencing Lots of sequence data on the internet Protocols available online Fedex Synthesis Data on Pathogens?

The good news Major weaponized biological agents have existed for decades Virulence, resistance, transmissibility were all enhanced prior to SB. The major advantage of our approach is putting together well characterized components. Creating new pathogens would require a full scale research effort

Summary • Engineering instead of Science • Modularity and Abstraction are powerful techniques • Mechanical Engineering, Electrical Engineering were all at the stage where it was “too complicated”.