Study Guide Cell Cycle DNA Replication and Mitosis

Study Guide: Cell Cycle, DNA Replication, and Mitosis

List the phases of the cell cycle in order. Draw a picture that represents the cell cycle. G 1, S, G 2, M

List the phases of mitosis in order. Draw each phase of mitosis. prophase, metaphase, anaphase, telophase

Explain what happens in prophase, metaphase, anaphase and telophase. • Prophase- centrioles move to poles; spindle forms; nucleus breaks down; chromosomes become visible • Metaphase- chromosomes line up at the equatorial plate • Anaphase - centromeres split and chromatids separate; they move to opposite poles • Telophase - two identical groups of chromosomes gather at opposite poles of the cell ; spindle breaks down; chromosomes spread out into chromatin; new nuclear membranes forms

Define mitosis. • process of division of the nucleus in eukaryotic cells

What happens in each of the phases of the cell cycle? • G 1 - cell growth • S - DNA is duplicated • G 2 - preparation for division • M - mitosis and cytokinesis

What is a centromere? Centriole? • Centromere—connects sister chromatids in a duplicated chromosome • Centriole—radiates the spindle

Which phases of the cell cycle occur during interphase? • G 1, S, G 2

Cells formed during mitosis are called _________. • daughter cells

During which stage of mitosis do the chromosomes first appear? • prophase

During which phase of mitosis do chromosomes line up in the middle of the cell? • metaphase

How do plant cells perform cytokinesis? • form a new cell wall between nuclei

How do animal cells perform cytokinesis? • the cell membrane pinches in

Why do cells undergo cell division? • growth, repair, & replacement, form of asexual reproduction

What is the role of the spindle during mitosis? • pulls chromosomes to opposite sides of the cell

What happens after mitosis and cytokinesis are completed? • the cells enter into interphase and the process starts again

What is a duplicated chromosome made up of? • 2 SISTER CHROMATIDS

After the process of DNA replication occurs, each daughter cell is able to receive an exact copy of the parent cell DNA following mitosis and cytokinesis.

If the sequence of bases on one strand of a DNA molecule is ATTGCCCATG, then what will be the sequence on the complementary DNA strand? TAACGGGTAC

In a portion of a gene, the base sequence is T-C-G-A-A-T. Which complementary base sequence would be found bonded to this section of the gene? A-G-C-T-T-A

What role do DNA helicases have in DNA replication? Unzips DNA

DNA replication results in 2 DNA molecules. How many strands of each are new and how many of each are original? The 2 DNA molecules produced contain one old & one new strand

During the process shown above, the 2 strands of DNA are unzipped. Then, DNA polymerases add complementary nucleotides to each strand which results in the formation of 2 identical DNA molecules. What is this process known as? DNA REPLICATION

Using the following, determine the complementary strand: DNA: TACCATTCCGATACCAAGACC Comp DNA: ATGGTAAGGCTATGGTTCTGG