Statistics of GBspeckles coding sequences of nucleotide sequences
Statistics of GB-speckles, coding sequences of nucleotide sequences of omp 1 gene of Chlamydia trachomatis, processed by s-LASCA technique S. S. Ulyanov a, b, O. V. Ulianova b, S. S. Zaytsev b, Yu. V. Saltykov b, V. A. Feodorova b
AFFILIATION a Saratov b Federal RUSSIA State University, RUSSIA Research Center for Virology and Microbiology, Branch in Saratov
ABSTRACT GB-speckles, simulated for nucleotide sequences of omp 1 gene of Chlamydia trachomatis, have been processed by s. LASCA technique. Statistics of LASCA-images of GB-speckles has been analyzed. Perspectives of application of suggested technique in modern bioinformatics have been demonstrated.
Nucleotide sequence omp 1 for E/Bour(E 1) ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGCTTCCT CCTTGCAAGCTCTGCCTGTGGGGAATCCTGCTGAACCAAGCCTTATGATCGACG GAATTCTGTGGGAAGGTTTCGGCGGAGATCCTTGCACCACTTGGTG TGACGCTATCAGCATGCGTATGGGTTACTATGGTGACTTTGTTTTCGACCGTGTT TTGAAAACAGATGTGAATAAAGAATTCCAAATGGGTGACAAGCCTACAAGTACT ACAGGCAATGCTACAGCTCCAACCACTCTTACAGCAAGAGAGAATCCTGCTTAC GGCCGACATATGCAGGATGCTGAGATGTTTACAAATGCCGCTTGCATGGCATTG AATATTTGGGATCGCTTTGATGTATTCTGTACACTAGGAGCCTCTAGCGGATACC TTAAAGGAAACTCTGCTTCTTTCAATTTAGTTGGATTGTTTGGAGATAATGAAAA TCAAAGCACGGTCAAAACGAATTCTGTACCAAATATGAGCTTAGATCAATCTGT TGTTGAACTTTACACAGATACTGCCTTCTCTTGGAGCGTGGGCGCTCGAGCAGCT TTGTGGGAGTGCGGATGTGCGACTTTAGGGGCTTCTTTCCAATACGCTCAATCTA AACCTAAAGTCGAAGAATTAAACGTTCTCTGTAACGCAGCTGAGTTTACTATCA ATAAGCCTAAAGGATATGTAGGGCAAGAATTCCCTCTTGCACTCATAGCAGGAA CTGATGCAGCGACGGGCACTAAAGATGCCTCTATTGATTACCATGAGTGGCAAGTTTAGCTCTTACAGATTGAATATGTTCACTCCCTACATTGGAGTTAA ATGGTCTCGAGCAAGTTTTGATGCCGATACGATTCGTATAGCCCAGCCAAAATC AGCTACAGCTATCTTTGATACTACCACGCTTAACCCAACTATTGCTGGAGCTGGC GATGTGAAAGCTAGCGCAGAGGGTCAGCTCGGAGATACCATGCAAATCGTCTCC TTGCAATTGAACAAGATGAAATCTAGAAAATCTTGCGGTATTGCAGTAGGAACG ACTATTGTAGATGCAGACAAATACGCAGTTACAGTTGAGACTCGCTTGATCGAT GAGAGAGCTGCTCACGTAAATGCACAATTCCGCTTCTAA
Nucleotide sequence omp 1 for E/IU-TC 0755 ut ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGCTTCCT CCTTGCAAGCTCTGCCTGTGGGGAATCCTGCTGAACCAAGCCTTATGATCGACG GAATTCTGTGGGAAGGTTTCGGCGGAGATCCTTGCACCACTTGGTG TGACGCTATCAGCATGCGTATGGGTTACTATGGTGACTTTGTTTTCGACCGTGTT TTGAAAACAGATGTGAATAAAGAATTCCAAATGGGTGACAAGCCTACAAGTACT ACAGGCAATGCTACAGCTCCAACCACTCTTACAGCAAGAGAGAATCCTGCTTAC GGCCGACATATGCAGGATGCTGAGATGTTTACAAATGCCGCTTGCATGGCATTG AATATTTGGGATCGCTTTGATGTATTCTGTACACTAGGAGCCTCTAGCGGATACC TTAAAGGAAACTCTGCTTCTTTCAATTTAGTTGGATTGTTTGGAGATAATGAAAA TCAAAGCACGGTCAAAACGAATTCTGTACCAAATATGAGCTTAGATCAATCTGT TGTTGAACTTTACACAGATACTGCCTTCTCTTGGAGCGTGGGCGCTCGAGCAGCT TTGTGGGAGTGCGGATGTGCGACTTTAGGGGCTTCTTTCCAATACGCTCAATCTA AACCTAAAGTCGAAGAATTAAACGTTCTCTGTAACGCAGCTGAGTTTACTATCA ATAAGCCTAAAGGATATGTAGGGCAAGAATTCCCTCTTGCACTCATAGCAGGAA CTGATGCAGCGACGGGCACTAAAGATGCCTCTATTGATTACCATGAGTGGCAAGTTTAGCTCTTACAGATTGAATATGTTCACTCCCTACATTGGAGTTAA ATGGTCTCGAGCAAGTTTTGATGCCGATACGATTCGTATAGCCCAGCCAAAATC AGCTACAGCTATCTTTGATACTACCACGCTTAACCCAACTATTGCTGGAGCTGGC GATGTGAAAGCTAGCACAGAGGGTCAGCTCGGAGATACCATGCAAATCGTCTCC TTGCAATTGAACAAGATGAAATCTAGAAAATCTTGCGGTATTGCAGTAGGAACG ACTATTGTAGATGCAGACAAATACGCAGTTACAGTTGAGACTCGCTTGATCGAT GAGAGAGCTGCTCACGTAAATGCACAATTCCGCTTCTAA
Comparison of the E/Bour(E 1) and E/IU-TC 0755 ut omp 1 nucleotide sequences
Algorithm of re-coding of nucleotide sequences and generation of gene-based speckles (GB-speckles) is described in: S. S. Ulyanov, S. S. Zaytsev, O. V. Ulianova, Y. V. Saltykov, V. A. Feodorova, "Using of methods of speckle optics for Chlamydia trachomatis typing“, Proc. of SPIE, vol. 10336, 103360 D-1 -9, (2017)
Three GB-speckle patterns are shown on the slides below • GB-speckle pattern for E/Bour(E 1) • GB-speckle pattern for E /IU-TC 0755 ut with one “artificial” mutation. One deletion is introduced in the beginning of nucleotide sequence
GB-speckle pattern for the E/Bour(E 1) omp 1
GB-speckle pattern for the E /IU-TC 0755 ut omp 1
GB-speckle pattern for the E/IU-TC 0755 ut omp 1 with a single mutation (Single Nucleotide Polymorphism, SNP)
Three phase map of GB-speckle patterns are shown below • GB-speckle pattern for E/Bour(E 1) • GB-speckle pattern for E /IU-TC 0755 ut with one “artificial” mutation. One deletion is introduced in the beginning of nucleotide sequence
Phase structure of GB-speckles for the E/Bour(E 1) omp 1
Phase structure of GB-speckles for the E /IU-TC 0755 ut omp 1
Phase structure of GB-speckles for the E/IU-TC 0755 ut with a single mutation (SNP)
s-LASCA processing of GB-speckles s-LASCA is based on the analysis of a single realization of static speckles. In this case, the entire two-dimensional implementation of the speckle field is divided into small areas, usually with a size of 5 x 5 or 7 x 7 pixels. For each of the selected areas, the local contrast value of the static speckles is calculated, after which a LASCA image is constructed.
s-LASCA image for GB-speckles, generated for E/Bour(E 1) nucleotide sequence. are demonstrated on next five slides. Size of subarea for speckle processing is varying.
s-LASCA image of GB-speckles, generated for the E/Bour(E 1) omp 1 nucleotide sequence. Subarea size for s-LASCA imaging is 3 x 3 pixels.
s-LASCA image of GB-speckles, generated for the E/Bour(E 1) omp 1 nucleotide sequence. Subarea size for s-LASCA imaging is 5 x 5 pixels.
s-LASCA image of GB-speckles, generated for the E/Bour(E 1) omp 1 nucleotide sequence. Subarea size for s-LASCA imaging is 7 x 7 pixels.
s-LASCA image of GB-speckles, generated for the E/Bour(E 1) omp 1 nucleotide sequence. Subarea size for s-LASCA imaging is 10 x 10 pixels.
s-LASCA image of GB-speckles, generated for the E/Bour(E 1) omp 1 nucleotide sequence. Subarea size for s-LASCA imaging is 15 x 15 pixels.
s-LASCA image, generated for GB-speckles, generated for E /IUTC 0755 ut are demonstrated on next five slides. Size of subarea for speckle processing is varying.
s-LASCA image for GB-speckles, generated for E /IU-TC 0755 ut. Subarea size for s-LASCA imaging is 3 x 3 pixels.
s-LASCA image for GB-speckles, generated for E /IU-TC 0755 ut. Subarea size for s-LASCA imaging is 5 x 5 pixels.
s-LASCA image for GB-speckles, generated for E /IU-TC 0755 ut. Subarea size for s-LASCA imaging is 7 x 7 pixels.
s-LASCA image for GB-speckles, generated for E /IU-TC 0755 ut. Subarea size for s-LASCA imaging is 10 x 10 pixels.
s-LASCA image for GB-speckles, generated for E /IU-TC 0755 ut. Subarea size for s-LASCA imaging is 15 x 15 pixels.
s-LASCA image, generated for E /IU-TC 0755 ut nucleotide sequence, having one mutation (deletion) are demonstrated on next four slides. Size of subarea for speckle processing is varying.
s-LASCA image of GB-speckles, generated for the E /IU-TC 0755 ut nucleotide sequence, having one mutation (deletion). Subarea size for s-LASCA imaging is 3 x 3 pixels.
s-LASCA image of GB-speckles, generated for the E /IU-TC 0755 ut nucleotide sequence, having one mutation (deletion). Subarea size for s-LASCA imaging is 5 x 5 pixels.
s-LASCA image of GB-speckles, generated for the E /IU-TC 0755 ut nucleotide sequence, having one mutation (deletion). Subarea size for s-LASCA imaging is 7 x 7 pixels.
s-LASCA image of GB-speckles, generated for the E /IU-TC 0755 ut nucleotide sequence, having one mutation (deletion). Subarea size for s-LASCA imaging is 10 x 10 pixels.
Results of mutual interference of GBspeckles, described above, is shown on three next slides
Interference of GB-speckles, generated for the E/IU-TC 0755 ut and the E/Bour(E 1) omp 1 nucleotide sequences
Interference of GB-speckles, generated for omp 1 nucleotide sequences of the E/IU-TC 0755 ut and the E/IU-TC 0755 ut with a single mutation (deletion)
s-LASCA image for interfering E /IU-TC 0755 ut GB-speckles and E/Bour(E 1) GB-speckles are demonstrated on next five slides. Size of subarea for speckle processing is varying.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and the omp 1 E/Bour(E 1) GB-speckles. Subarea size for s-LASCA imaging is 3 x 3 pixels.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and the omp 1 E/Bour(E 1) GB-speckles. Subarea size for s-LASCA imaging is 5 x 5 pixels.
s-LASCA image for interfering E /IU-TC 0755 ut GB-speckles and E/Bour(E 1) GB-speckles. Subarea size for s-LASCA imaging is 7 x 7 pixels.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and the omp 1 E/Bour(E 1) GB-speckles. Subarea size for s-LASCA imaging is 10 x 10 pixels.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and the omp 1 E/Bour(E 1) GB-speckles. Subarea size for s-LASCA imaging is 15 x 15 pixels.
s-LASCA image for interfering E /IU-TC 0755 ut GB-speckles and π-phase shifted GB-speckles (generated for the same nucleotide sequence) are demonstrated on next five slides. Size of subarea for speckle processing is varying.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and π-phase shifted GB-speckles (generated for the same nucleotide sequence). Subarea size for s-LASCA imaging is 3 x 3 pixels.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and πphase shifted GB-speckles (generated for the same nucleotide sequence). Subarea size for s-LASCA imaging is 5 x 5 pixels.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and πphase shifted GB-speckles (generated for the same nucleotide sequence). Subarea size for s-LASCA imaging is 7 x 7 pixels.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and π-phase shifted GB-speckles (generated for the same nucleotide sequence). Subarea size for s-LASCA imaging is 10 x 10 pixels.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and π-phase shifted GB-speckles (generated for the same nucleotide sequence). Subarea size for s-LASCA imaging is 15 x 15 pixels.
s-LASCA image for interfering E /IU-TC 0755 ut GB-speckles and GBspeckles, generated for the same nucleotide sequence with one mutation (deletion) are demonstrated on next five slides. Size of subarea for speckle processing is varying.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and GBspeckles, generated for the same nucleotide sequence with a single mutation (deletion). Subarea size for s-LASCA imaging is 3 x 3 pixels.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and GBspeckles, generated for the same nucleotide sequence with a single mutation (deletion). Subarea size for s-LASCA imaging is 5 x 5 pixels.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and GBspeckles, generated for the same nucleotide sequence with a single mutation (deletion). Subarea size for s-LASCA imaging is 7 x 7 pixels.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and GBspeckles, generated for the same nucleotide sequence with a single mutation (deletion). Subarea size for s-LASCA imaging is 10 x 10 pixels.
s-LASCA image for interfering of the omp 1 E/IU-TC 0755 ut GB-speckles and GBspeckles, generated for the same nucleotide sequence with a single mutation (deletion). Subarea size for s-LASCA imaging is 15 x 15 pixels.
Summary • GB-speckle, processed using s-LASCA technique, becomes more informative. s-LASCA images contains a lot of minutia, positions of these peculiarities depend on the number of mutations and their positions in the initial nucleotide sequences. • s-LASCA images of interfering GB-speckles are more informative then bare GB-speckles, processed using s-LASCA technique.
ACKNOWLEDGEMENT This research has been supported by Russian Science Foundation, grant # 17 -16 -01099
THANK YOU FOR ATTENTION!
- Slides: 58