Sitespecific mutagenesis DNA PCR Sitespecific mutagenesis Horton 1997

  • Slides: 15
Download presentation

Site-specific mutagenesis 특정 DNA 염기서열에 돌연변이를 도입하는 기법으로 분자생물학의 핵심기술이다. PCR을 응용한 다양한 Site-specific

Site-specific mutagenesis 특정 DNA 염기서열에 돌연변이를 도입하는 기법으로 분자생물학의 핵심기술이다. PCR을 응용한 다양한 Site-specific mutagenesis 기법이 개발되었으며 계속 진화하고 있 다 (Horton, 1997; Horton et al. , 1993) 이를 “PCR-mediated site-directed mutagenesis”라고 한다. 최근 가장 진화한 형태인 “Overlap extension PCR”이 이용되고 있다. (Lee et al. , 2004) • The cause of mutagenesis. • The types of mutagenesis. 1. UV. 1. Single base mutation. 2. Chemical-Carcinogen. 2. Multiple mutation. 3. Error prone of PCR. 3. Insertion. 4. Site-directed mutagenesis. 4. Deletion.

Overlap extension PCR

Overlap extension PCR

Overlap Extension PCR Primer design Sense template (주형) 5’ 541 586 631 676 721

Overlap Extension PCR Primer design Sense template (주형) 5’ 541 586 631 676 721 ttcacatgccctcagtgccgaaagagctttcctcggcggagcttc cgccccaacctgcagctggccaatatggtccaggtgattcggcag atgcacccaacccctggtcgagggagccgcgtgaccgatcagggc atctgtcccaaacaccaagaagccctgaagctcttctgcgaggta gacgaagaggccatctgtgtgccgagaatccaggagccac 3’ F (Forward) Anti-sense template와 결합 R (Reverse) Sense template와 결합 Primer A (F): 5’- atgccctcagtgccgaaagag - 3’ Primer B (R): 5’- tgattcggcagatgcacccgatcaggg - 3’ 5’- ccctgatcgggtgcatctgccgaatca - 3’ Primer C (F): 5’- agatgcacccgatcagggcatctgtcc - 3’ Primer D (R): 5’- gtgtgccgagaatccaggagc - 3’ 5’- gctcctggattctcggcacac - 3’ Reverse primer의 경우 주형 template sequence 그대로 design하면 Anti-sense template에 붙기 때문에 상보적인 Sequence로 바꿔주어 sense template에 결합하게함 상보적인 Sequence 로 바꿔줌

Experimental Procedure : Gel Extraction 1. Agarose gel : membrane binding solution = 10

Experimental Procedure : Gel Extraction 1. Agarose gel : membrane binding solution = 10 mg : 10 ㎕ 씩 넣어 55℃ heat block에서 10분간 녹인다. 2. 잘 녹았는지를 vortexing 을 통해 확인 후, sample을 column으로 옮긴다. 3. 14000 rpm, 1 min centrifuge 4. Wash buffer 750 ㎕ 를 넣은 후 14000 rpm, 1 min centrifuge 5. 한번 더 14000 rpm, 1 min centrifuge하여 남은 wash buffer를 제거한다. 6. Column을 새 tube에 옮긴 후 D. W. 를 30 ㎕ 를 넣고 5분을 기다린다. 7. 14000 rpm, 5 min centrifuge

Experimental Procedure : Ligation PCR Component PCR condition Quantity per reaction Targets 1 -10

Experimental Procedure : Ligation PCR Component PCR condition Quantity per reaction Targets 1 -10 kb Distilled water 34. 5 ㎕ 5 x Herculase II reaction buffer 10 ㎕ d. NTP mix 0. 5 ㎕ DNA template(A+B) 1㎕ DNA template(C+D) 1㎕ Primer A, D Each 1㎕ Herculase II fusion DNA polymerase 1㎕ Total reaction volume 50 ㎕ Temp. (℃) Time 95 2 min 95 30 sec 55 30 sec 72 1 min 30 cycles 72 5 min

Ligation PCR Result

Ligation PCR Result

Overlap Extension PCR Cloning Transformation Bacteria culture Plasmid DNA Extraction

Overlap Extension PCR Cloning Transformation Bacteria culture Plasmid DNA Extraction

PCR fragment for cloning into T-vector PCR polymerase의 종류 Taq DNA polymerase • 3’→

PCR fragment for cloning into T-vector PCR polymerase의 종류 Taq DNA polymerase • 3’→ 5’ exonuclease (proofreading) activity 없음 • 3’- A overhang 을 갖음 Pfu DNA polymerase • 3’→ 5’ exonuclease (proofreading) activity 있음 • Heat stability와 fidelity가 뛰어남 • Error rate가 적음

Experimental Procedure 1. T-vector ligation Ingredient Volume ( ul) 2 x ligation buffer 5

Experimental Procedure 1. T-vector ligation Ingredient Volume ( ul) 2 x ligation buffer 5 T-vector 0. 5 PCR construct (insert) 3. 5 T 4 DNA ligase 1 Total 10 Ligation time 1. Overnight at 16 ℃ 2. 1 ~ 2 hours at Room temperature ◈ Ligation volume setting ng of vector size of vector : ng of insert size of insert = 1 : 5

Experimental Procedure 2. Transformation Positive control Control insert (542 bp) Self-ligation No insert

Experimental Procedure 2. Transformation Positive control Control insert (542 bp) Self-ligation No insert

Amp/Lac. Z를 이용한 selection X-gal used to indicate whether a bacterium expresses the β-galactosidase

Amp/Lac. Z를 이용한 selection X-gal used to indicate whether a bacterium expresses the β-galactosidase enzyme, which is encoded by the lac Z gene, in a technique called blue/white screening.

Experimental Procedure 3. Bacteria culture 16 hr 4. Plasmid DNA Extraction MIDI preparation

Experimental Procedure 3. Bacteria culture 16 hr 4. Plasmid DNA Extraction MIDI preparation

Report – 결과 및 고찰 1. Gel extraction solution 의 원리 조사 Membrane Wash

Report – 결과 및 고찰 1. Gel extraction solution 의 원리 조사 Membrane Wash Solution 1. 10 m. M potassium acetate (p. H 5. 0) 2. 80% ethanol 3. 16. 7μM EDTA (p. H 8. 0) Membrane Binding Solution 1. 4. 5 M guanidine isothiocyanate 2. 0. 5 M potassium acetate (p. H 5. 0) 2. Taq polymerase와 Pfu polymerase에 대해 비교 조사