Sitespecific mutagenesis DNA PCR Sitespecific mutagenesis Horton 1997
- Slides: 15
Site-specific mutagenesis 특정 DNA 염기서열에 돌연변이를 도입하는 기법으로 분자생물학의 핵심기술이다. PCR을 응용한 다양한 Site-specific mutagenesis 기법이 개발되었으며 계속 진화하고 있 다 (Horton, 1997; Horton et al. , 1993) 이를 “PCR-mediated site-directed mutagenesis”라고 한다. 최근 가장 진화한 형태인 “Overlap extension PCR”이 이용되고 있다. (Lee et al. , 2004) • The cause of mutagenesis. • The types of mutagenesis. 1. UV. 1. Single base mutation. 2. Chemical-Carcinogen. 2. Multiple mutation. 3. Error prone of PCR. 3. Insertion. 4. Site-directed mutagenesis. 4. Deletion.
Overlap extension PCR
Overlap Extension PCR Primer design Sense template (주형) 5’ 541 586 631 676 721 ttcacatgccctcagtgccgaaagagctttcctcggcggagcttc cgccccaacctgcagctggccaatatggtccaggtgattcggcag atgcacccaacccctggtcgagggagccgcgtgaccgatcagggc atctgtcccaaacaccaagaagccctgaagctcttctgcgaggta gacgaagaggccatctgtgtgccgagaatccaggagccac 3’ F (Forward) Anti-sense template와 결합 R (Reverse) Sense template와 결합 Primer A (F): 5’- atgccctcagtgccgaaagag - 3’ Primer B (R): 5’- tgattcggcagatgcacccgatcaggg - 3’ 5’- ccctgatcgggtgcatctgccgaatca - 3’ Primer C (F): 5’- agatgcacccgatcagggcatctgtcc - 3’ Primer D (R): 5’- gtgtgccgagaatccaggagc - 3’ 5’- gctcctggattctcggcacac - 3’ Reverse primer의 경우 주형 template sequence 그대로 design하면 Anti-sense template에 붙기 때문에 상보적인 Sequence로 바꿔주어 sense template에 결합하게함 상보적인 Sequence 로 바꿔줌
Experimental Procedure : Gel Extraction 1. Agarose gel : membrane binding solution = 10 mg : 10 ㎕ 씩 넣어 55℃ heat block에서 10분간 녹인다. 2. 잘 녹았는지를 vortexing 을 통해 확인 후, sample을 column으로 옮긴다. 3. 14000 rpm, 1 min centrifuge 4. Wash buffer 750 ㎕ 를 넣은 후 14000 rpm, 1 min centrifuge 5. 한번 더 14000 rpm, 1 min centrifuge하여 남은 wash buffer를 제거한다. 6. Column을 새 tube에 옮긴 후 D. W. 를 30 ㎕ 를 넣고 5분을 기다린다. 7. 14000 rpm, 5 min centrifuge
Experimental Procedure : Ligation PCR Component PCR condition Quantity per reaction Targets 1 -10 kb Distilled water 34. 5 ㎕ 5 x Herculase II reaction buffer 10 ㎕ d. NTP mix 0. 5 ㎕ DNA template(A+B) 1㎕ DNA template(C+D) 1㎕ Primer A, D Each 1㎕ Herculase II fusion DNA polymerase 1㎕ Total reaction volume 50 ㎕ Temp. (℃) Time 95 2 min 95 30 sec 55 30 sec 72 1 min 30 cycles 72 5 min
Ligation PCR Result
Overlap Extension PCR Cloning Transformation Bacteria culture Plasmid DNA Extraction
PCR fragment for cloning into T-vector PCR polymerase의 종류 Taq DNA polymerase • 3’→ 5’ exonuclease (proofreading) activity 없음 • 3’- A overhang 을 갖음 Pfu DNA polymerase • 3’→ 5’ exonuclease (proofreading) activity 있음 • Heat stability와 fidelity가 뛰어남 • Error rate가 적음
Experimental Procedure 1. T-vector ligation Ingredient Volume ( ul) 2 x ligation buffer 5 T-vector 0. 5 PCR construct (insert) 3. 5 T 4 DNA ligase 1 Total 10 Ligation time 1. Overnight at 16 ℃ 2. 1 ~ 2 hours at Room temperature ◈ Ligation volume setting ng of vector size of vector : ng of insert size of insert = 1 : 5
Experimental Procedure 2. Transformation Positive control Control insert (542 bp) Self-ligation No insert
Amp/Lac. Z를 이용한 selection X-gal used to indicate whether a bacterium expresses the β-galactosidase enzyme, which is encoded by the lac Z gene, in a technique called blue/white screening.
Experimental Procedure 3. Bacteria culture 16 hr 4. Plasmid DNA Extraction MIDI preparation
Report – 결과 및 고찰 1. Gel extraction solution 의 원리 조사 Membrane Wash Solution 1. 10 m. M potassium acetate (p. H 5. 0) 2. 80% ethanol 3. 16. 7μM EDTA (p. H 8. 0) Membrane Binding Solution 1. 4. 5 M guanidine isothiocyanate 2. 0. 5 M potassium acetate (p. H 5. 0) 2. Taq polymerase와 Pfu polymerase에 대해 비교 조사
- Dna replication vs pcr
- Oligonucleotide directed mutagenesis
- Mutagenesis definition biology
- Mcb 317
- Insertional mutagenesis
- Gene shuffling
- Insertional mutagenesis
- Mutagénesis dirigida
- Directed mutagenesis and protein engineering
- Coding dna and non coding dna
- What are the enzymes involved in dna replication
- Function of dna polymerase 3
- Dna and genes chapter 11
- Bioflix activity dna replication lagging strand synthesis
- Pcr wikiskripta
- Pcr technique