Simulated Lab Relationships Biodiversity Botana curus is a
Simulated Lab Relationships & Biodiversity Botana curus is a valuable plant because it produces Curol, a compound used for treating certain kinds of cancer. Curol can not be produced in the laboratory. Botana curus grows very slowly and is on the endangered species list, so its ability to provide curol in large quantities is limited.
Your Task Species that are closely related to Botana curus are likely to produce the important substance curol. Therefore we need to identify closely related species.
Test 1: Compare Plant Structure
Test 2: Compare Seeds Compare the structural characteristics of the seed samples. Record your observations in Table 1.
Test 3: Compare Stem Structures Botana curus Species X Species Y Species Z Compare the structural characteristics of the stem samples. State whether the arrangement of the bundles of conducting tissue is circular or scattered. Record your observations in Table 1.
p. 2 Hypothesis • a. You must make a hypothesis about which Species (X, Y, or Z) is most closely related to Botana curus based upon ONLY Tests 1 -3 • b. provide supporting evidence for your hypothesis using data only from Tests 1 -3
Test 4: Chromatography
Test 5: Enzyme M
Test 6: Gel Electrophoresis ATTCCGGATCGCCGGATATACTCCGGTAATATC Botana curus ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species X ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Y ATTCCGGATCGCCGGATATTCTCCGGTAATATC Species Z
# of DNA Bases 24 23 22 21 20 19 18 17 16 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 Botana curus Species X Species Y Species Z
Test 7: Molecular Evidence for Relationships (p. 4) • B. c. CAC GTG GAC TGA GGA CTC ACU CCU GAG m. RNA GUG ___ CAC ___ CUG ___ ____ ___ VAL HIS LEU THR ____ PRO GLU ___ GLU Amino ___ ___ ___ • X CAC GTG GAC AGA GGA CAC CTC CAC CUG ___ UCU ____ CCU GUG GAG m. RNA GUG ___ ___ ___ HIS LEU SER ____ PRO VAL ___ GLU Amino VAL ___ ___ ___
Test 7: Molecular Evidence for Relationships (p. 4) • Y CAC GTG GAC AGA GGA CAC CTC CAC CUG UCU ____ CCU GUG ___ GAG m. RNA GUG ___ ___ ___ VAL HIS LEU SER ____ PRO VAL ___ GLU Amino ___ ___ ___ • Z CAC GTA GAC TGA GGA CTT CTC CAU CUG ACU ____ CCU GAA ___ GAG m. RNA GUG ___ ___ ___ HIS LEU THR ____ PRO GLU Amino VAL ___ ___ ___
p. 5 • It is the same as Species Z and different from Species X and Y. 1. Species Z. Botana curus and Species Z both make enzyme M, have the same pigments, and have the exact same amino acid sequence which is evidence that they are closely related. 2. Supported. The molecular evidence supported my hypothesis. OR Refuted. The molecular evidence showed that Botana curus was more closely related to Species Z
p. 5 3. Molecular. Organisms can look alike on the surface, but have many hidden molecular differences. 4. Having needles, seeds, blue & yellow pigments, and some amino acids (DNA fragments) in common.
p. 6 5. These common characteristics are most likely due to common ancestry. 6. 2. This tree shows Z and Botana curus closer together. 7. Additional evidence may include using indicators to test for other enzymes, comparing fossil records, or comparing DNA fragments using other restriction enzymes.
p. 7 • 8. Pollution, deforestation, overhunting, destruction of natural habitats • 9. It provides Curol to treat cancer, Maybe the plant has future abilities to provide medicine or food, Extinction is irreversible. • 10. Expensive to preserve its habitat, another “species” is closely related to Botana curus so it might make Curol too.
Species Botana curus Species X Species Y Species Z Plants Seeds Micro. Circular Scattered Paper Chrom. Blue Yellow Pink Blue Yellow Enzyme M Amino Acid Gel Electro NONE 4 bands 5, 9, 11, 12 Present 2 differences Absent Present SER not THR Val not GLU 2 differences 3 bands 7, 8, 22 4 bands 3, 5, 12, 17 SER not THR Val not GLU Circular Blue Yellow Pink Present No differences 4 bands 5, 9, 11, 12
- Slides: 18