RNA interference RNAi A cellular response to the
















- Slides: 16
RNA interference (RNAi) A cellular response to the presence of double-stranded RNA that results in the sequence-specific degradation of m. RNA. A tool for molecular genetic investigation - reverse genetics. Lab synthesized small ds. RNA molecules are called small interfering RNAs or si. RNAs. Klug et al. , 9 th Ed.
RNA interference (RNAi) A cellular response to the presence of double-stranded RNA that results in the sequence-specific degradation of m. RNA. A tool for molecular genetic investigation - reverse genetics. ds. RNA GAUCGAUCGAUC CUAGCUAGCUAG m. RNA m 7 GGAUCGAUCGAUCAAAAAAA degradation
The mechanism of RNAi ds. RNA in the cytoplasm
The mechanism of RNAi Dicer ds. RNA in the cytoplasm Dicer is an enzyme that cuts ds. RNA into fragments 20 -25 bp long with 2 -3 bp overhangs
The mechanism of RNAi Dicer ds. RNA in the cytoplasm Dicer is an enzyme that cuts ds. RNA into fragments 20 -25 bp long with 2 -3 bp overhangs Small interfering RNAs (si. RNAs)
The mechanism of RNAi RISC si. RNA The RNA-induced silencing complex (RISC) is a multi-protein machine that binds to si. RNAs and breaks H-bonds between the two strands.
The mechanism of RNAi RISC si. RNA The RNA-induced silencing complex (RISC) is a multi-protein machine that binds to si. RNAs and breaks H-bonds between the two strands. RISC with ss. RNA Other ss. RNA strand free
The mechanism of RNAi RISC with ss. RNA RISC targets the ss. RNA to m. RNA in a sequence-specific manner. m. RNA m 7 G poly A tail
The mechanism of RNAi RISC with ss. RNA RISC targets the ss. RNA to m. RNA in a sequence-specific manner. m. RNA m 7 G poly A tail
The mechanism of RNAi m 7 G poly A tail RISC catalyzes cleavage of m. RNA 7 G m poly A ta il
The mechanism of RNAi poly 7 G m no poly A tail no methylated cap A ta il
The mechanism of RNAi poly 7 G m no poly A tail no methylated cap RNAses destroy m. RNA A ta il
si. RNAs can be synthesized and introduced into cells to target specific genes for “knockdown”. ds. RNA triggers an Interferon response (a type of immune response) in vertebrates stops protein synthesis, can induce cell death Klug et al. , 9 th Ed.
RNAi as an antiviral mechanism
Gel Mobility Shift Assay An assay to determine in vitro binding of a protein to DNA Protein and “hot” DNA can be mixed and run on an acrylamide gel. Unbound DNA runs at a speed that correlates with its size and bound DNA runs slower through the gel. Molecular Biology of the Cell, Alberts, 4 th ed.
Gel Mobility Shift Assay Lodish, Molecular Cell Biology