Ribonucleic Acid Proteins Protein synthesis Transcription translation During

Ribonucleic Acid Proteins Protein synthesis Transcription translation During transcription, RNA polymerase unwinds the DNA and adds in the complementary nucleotides to make a single stranded piece of m. RNA. Ligase helps the DNA strand close and the m. RNA moves out of the nucleus. During translation, a ribosome attaches to the m. RNA at the start codon (AUG). The codons on the m. RNA match with the complementary anti-codons on t. RNA molecules, which carry the amino acids. The amino acids at strung together forming a polypeptide. Insulin is a hormone that carries a signal from cell-to-cell, telling the body to absorb glucose out of the blood.

To maintain the integrity of the DNA, and so that multiple proteins can be made at once (from multiple m. RNA molecules). m. RNA ribose uracil 3 Unwinds the DNA double helix and adds in complementary RNA nucleotides. uracil

3 nucleotides in a row on a strand of m. RNA that code for an amino acid Only m. RNA The structure and function of a protein is determined by the order of the amino acids and their chemical properties. The genetic code is the set of “rules” or code that allows us to transfer a DNA sequence into a protein.

64 20 amino acid The same base pair rules and codon table can be used to transcribe and translate proteins for all living organisms. out of the nucleus (cytoplasm) 3 Ribosome (made of r. RNA) r. RNA stands for ribosomal RNA. This RNA makes up the ribosome and is the place where m. RNA is translated into a protein. t. RNA stands for transfer RNA. This RNA has an anti-codon on one end and the amino acid on the other. t. RNA matches its anti-codon with the codon on the m. RNA during translation, “dropping off” the correct amino acid at the ribosome.

A 3 -nucleotide sequence on t. RNA that is complementary to the codon. The anti-codon “tells” the t. RNA where to take its amino acid, just like an address “tells” the mailman where to take the envelope. A stop codon (UAA, UAG, UGA) 4 6 3 5 2

Endomembrane system

Ribosomes made by the rough ER are either excreted out of the cell, imbedded into the cell membrane, or left inside a vesicle to become a lysosome. nucleolus Bound ribosome Nucleus/nuclear membrane Rough ER Smooth ER Vesicle Golgi complex Lysosome Cell membrane

AUGGGGCUACGAUUAGUCCUGAGG Met - Gly - Leu – Arg – Leu – Val – Leu – Arg AAA, AAG

Substrate Active site Enzyme Products