Restriction Mapping of a Bacterial Plasmid Danna and
Restriction Mapping of a Bacterial Plasmid (Danna and Nathans, 1971)
Plasmids • Small, autonomously replicating extrachromosomal pieces of DNA found in bacteria, archaea and some eukaryotes • Usually circular • Contain an origin of replication • Usually contain genes conferring advantage on host (e. g. antibiotic resistance) • Play an important role in conjugation (bacterial sex) and lateral gene transfer
Plasmids
Plasmids
Plasmids
Plasmids
Restriction Enzymes Restriction endonucleases are bacterial enzymes that cleave double-stranded DNA at specific sequences (usually 4 -8 basepairs in length) Discovered in 1970 by Tom Kelly and Ham Smith.
A Restriction Enzyme (Bg. II)
Eco. RI 5’ G/AATTC 3’ 3’ CTTAA/G 5’ CGTAGCGAATTCGTGCGATGCATCGCTTAAGCACGCTACGTA
Eco. RI 5’ G/AATTC 3’ 3’ CTTAA/G 5’ CGTAGCG AATTCGTGCGATGCATCGCTTAA GCACGCTACGTA
Restriction Enzymes • > 3, 500 different restriction enzymes • > 270 different specificities • Named for species and strain from which they were originally isolated: – Escherichia coli R Eco. RI – Bacillus amyloliquefaciens H Bam. HI – Providencia stuartii Pst. I
Restriction Enzyme Examples Mse. I 5’ A/T A A 3’ 3’ T A T/A 5’ Bam. HI 5’ G/G A T C C 3’ 3’ C C T A G/G 5’ Eco. RI 5’ G/A A T T C 3’ 3’ C T T A A/G 5’ Hind. III 5’ A/A G C T T 3’ 3’ T T C G A/A 5’ Not. I 5’ G C/G G C C G C 3’ 3’ C G C C G G/C G 5’ 4 cutter 6 cutters 8 cutter
Restriction Map
Restriction Digest Eco. RI 4361 bp Hind. III 4361 bp Bam. HI 4361 bp Acc. I Apa. LI 1593 bp 2768 bp 2617 bp 1246 bp 498 bp
Agarose Gels • To visualize the results of a restriction digest, you need to separate the different fragments of DNA, and determine their size • We will do this by agarose gel electophoresis
Agarose • Agarose is very water soluble polysaccharide • Forms porous, aqueous gels after heating and cooling
Electrophoresis - 6000 4000 3000 power supply 2000 1500 1000 500 200 +
Gel Visualized Under UV Light
Plasmids on Agarose Gels uncut once
EXPERIMENT 1: MAPPING DNA • Session 1: single enzyme digests and agarose gel #1 • Session 2: double digests and agarose gel #2 • Session 3: more digests and agarose gel #3 • Session 4: run and blot gel #4 • Session 5: complete DNA blot.
Today’s Experiment Restriction Digest of Plasmid Each lab pair you will be given a 300µl aliquot of plasmid DNA at a concentration of approximately 100µg/ml in: TE: 10 m. M Tris-HCl, 1 m. M EDTA p. H 8 NOTE: This is a stock solution, you will only use a small amount for each reaction
Restriction Digest of Plasmid For each restriction digest, mix: 5 ul DNA (@100 ug/ul = 0. 5 ug DNA) 3 ul 5 x buffer (100 m. M Na. Cl, 10 m. M Tris-Hcl p. H 7. 5, 10 m. M Mg. Cl 2, 50 ug/ul) 6 ul sterile water 1 ul enzyme Incubate for 1 hour at 37 C Add 4 ul “stop mix” (50% glycerol, 1% SDS, 50 m. M EDTA, 0. 1% bromphenyl blue)
Restriction Enzymes for This Experiment Bam. HI 5’ G/G A T C C 3’ 3’ C C T A G/G 5’ Eco. RI 5’ G/A A T T C 3’ 3’ C T T A A/G 5’ Hind. III 5’ A/A G C T T 3’ 3’ T T C G A/A 5’ Pst. I 5’ C T G C A/G 3’ 3’ G/A C G T C 5’ Sca. I 5’ A G T/A C T 3’ 3’ T C A/T G A 5’ Xba. I 5’ T/C T A G A 3’ 3’ A G A T C/T 5’ Xho. I 5’ C/T C G A G 3’ 3’ G A G C T/C 5’
Your Gel Today Size standards Xho. I Xba. I Sca. I Pst. I Hind. III Eco. RI Bam. HI Size standards
Your Gel Today Size Xho. I Xba. I Sca. I Pst. I Hind. III Eco. RI Bam. HI Size 6000 4000 3000 2000 1500 1000 500 200
- Slides: 25