Restriction Enzyme Digestion Southern Blotting of DNA Experiment
Restriction Enzyme Digestion & Southern Blotting of DNA
Experiment Goals Digestion of DNA by restriction enzyme Analyze digested DNA by electrophoresis Transfer digested DNA to nitrocellulose filters (Southern blotting) – Procedure of setting up a Southern blotting
Restriction Enzymes Definition: • A restriction enzyme (or restriction endonuclease) is an enzyme that cuts double-stranded DNA at specific sites that it recognizes. • The enzyme makes two incisions, one through each of the sugar-phosphate backbones (i. e. , each strand) of the double helix without damaging the nitrogenous bases.
Restriction enzyme The enzyme Eco. RI cutting DNA at its recognition sequence • Different restriction enzymes have different recognition sequences. • This makes it possible to create a wide variety of different gene fragments.
Function of Restriction Enzymes in microorganisms Provide microorganisms with resistance to invading organisms or foreign DNA. Endonucleases in bacterial cells resist infections by viruses, by destroying foreign DNA molecules. consist of a related pair of enzymes – Endonuclease – cuts foreign DNA – Methylase – protects host DNA
Methylase Enzymes Restriction enzymes usually occur in combination with one or two modification enzymes (DNAmethyltransferases) Protect the cell’s own DNA from cleavage by the restriction enzyme. Modification enzymes recognize the same DNA sequence as the restriction enzyme that they accompany, Instead of cleaving the sequence, they methylate one of the bases in each of the DNA strands. The methyl groups protrude into the major groove of DNA at the binding site and prevent the restriction enzyme from acting upon it.
Naming Restriction enzymes are named based on the bacteria in which they are isolated in the following manner: example “Eco. RI” E Escherichia (genus) co coli (species) R RY 13(strain) I First identified Order
Restriction Enzyme There are hundreds of different REs from different microorganisms Each RE cuts DNA at a specific “recognition sequence” of nucleotides. Examples: Eco. RI-- GAATTC; Alu. I -- AGCT Each recognizes its specific “recognition sequence” and cuts both strands of DNA wherever that sequence is found, but no where else.
Restriction Enzyme Uses Recombinant DNA technology Cloning – Replicates a sequence inserted into a host cell DNA restriction mapping – A rough map of a DNA fragment DNA fingerprints
Types of Restriction Enzymes Restriction enzymes are traditionally classified into three types on the basis of – – subunit composition, cleavage position, sequence-specificity and cofactor-requirements
Types of Restriction Enzymes Type I - Recognize specific sequences and cut DNA at a nonspecific site > than 1, 000 bp away Type II - Recognize palindromic sequences and cut within the palindrome Type III - Recognize specific 5 -7 bp sequences and cut 24 -27 bp down stream of the site. Type II restriction enzymes are the most useful class as they recognize specific palindomic sequences in DNA and cut the sugar phosphate backbone within the palindrome
Restriction Enzymes and DNA fragments A restriction enzyme functions by "scanning" the length of a DNA molecule. Once it encounters its particular specific recognition sequence, – it will bind to the DNA molecule – and makes one cut in each of the two sugar-phosphate backbones of the double helix.
Endonucleases and DNA fragments Blunt ends Sticky ends
Unit Determination Assay One unit of restriction endonuclease is defined as the amount of enzyme required to digest one microgram of the appropriate substrate DNA completely in 60 minutes under the conditions specified for that enzyme.
Set up of a restriction enzyme reaction A RE reaction contains the DNA to be analyzed, A restriction enzyme buffer mix. – contains a buffering agent to maintain constant p. H, – and Mg++ (from Mg. Cl 2) as a necessary cofactor for enzyme activity.
Hinf. I Restriction Enzyme Recognition Site:
Electrophoresis of Genomic DNA Odd numbered lanes contain undigested genomic DNA Even numbered lanes contain digested genomic DNA
Southern Blotting
Southern Blotting The technique was developed by E. M. Southern in 1975.
What Is Southern Blotting? A technique used in molecular biology to check for the presence of a particular DNA sequence in a DNA sample.
Southern Blot The Southern Blot takes advantage of the fact that DNA fragments will stick to a nylon or nitrocellulose membrane. The membrane is laid on top of the agarose gel and absorbent material (e. g. paper towels or a sponge) is placed on top. With time, the DNA fragments will travel from the gel to the membrane by capillary action as surrounding liquid is drawn up to the absorbent material on top. The membrane is now a mirror image of the agarose gel.
Uses of Southern Blotting Identify mutations, deletions, and gene rearrangements Used in prognosis of cancer and in prenatal diagnosis of genetic diseases diagnosis of Leukemias detect variations in gene structure identify homologous genes among different species
Performing Southern Blotting 1. DNA Digestion with an appropriate restriction enzyme. 2. Gel Electrophoresis run the digest on an agarose gel. 3. Denature the DNA (usually while it is still on the gel). 4. Transfer the denatured DNA to the membrane (blotting) 5. Preparing the probe 6. Hybridization Probe the membrane with labeled ss. DNA. 7. Detection Visualize your radioactively labeled target sequence.
1 - DNA Digestion Cut the DNA into different sized pieces. Hinf. I restriction enzyme is used
2 - Gel Electrophoresis Sorts the DNA pieces by size Agarose or polyacrimide
Electrophoresis of Genomic DNA Odd numbered lanes contain undigested genomic DNA Even numbered lanes contain digested genomic DNA
3 - Denature the DNA is then denatured with an alkaline solution such as NAOH. This causes the double stranded to become single-stranded.
4 - Blotting Transfer the DNA from the gel to a solid support. The blot is usually done on a sheet of nitrocellulose paper or nylon. Transferred by capillary blotting.
4 - Blotting Capillary blotting-fragments are eluted from the gel and deposited onto the membrane by buffer that is drawn through the gel by capillary action. Agar gel with DNA Wick (filter paper) Buffer Weight Paper towel stack Filter paper Membrane
4 - Blot Fixation The blot is made permanent by: – Drying at ~80°C – Exposing to UV irradiation
5 - Preparing the probe It is a fragment of DNA of variable length (usually 100 -1000 bases long), which is used to detect in DNA the presence of nucleotide sequences that are complementary to the sequence in the probe Must be labeled to be visualized Usually prepared by making a radioactive copy of a DNA fragment. Probing is often done with 32 P labeled ATP, biotin/streptavidin or a bioluminescent probe.
6 - Hybridization-process of forming a doublestranded DNA molecule between a singlestranded DNA probe and a single-stranded target patient DNA.
6 - Hybridization Steps for hybridization 1. The labeled probe is added to the matrix incubated for several hours to allow the probe molecules to find their targets 2. Any unbound probes are then removed. 3. The place where the probe is connected corresponds to the location of the immobilized target molecule.
probes add probe 3’ – *ATCTCGGGAATC – 5’ hybridization 5’ – …AAGCCTAGAGCCCTTAGCCAAAAG… – 3’ * ATCTCGGGAATC
7 - Detection Visualize your labeled target sequence. If radiolabeled 32 P probe is used, then you would visualize by autoradiography. Biotin/streptavidin detection is done by colorimetric methods, and bioluminescent visualization uses luminescence.
Steps in Southern Blotting DNA extraction Disease gene Fragments of DNA appear as a smear DNA digestion Gel electrophoresis Blot dismantled Paper towels Chromatography paper support Nylon filter Gel 10 x SSC Denaturation of patient’s DNA in gel Gel in Na. OH Southern blot Autoradiography X ray film Hybridisation: Stringency washes Radioactive probe added to filter cassette filter
Southern Blot of same DNA (final result on x-ray film)
Southern Blotting Animation
- Slides: 39