Recombinant DNA Technology for the nonscience major Historical
Recombinant DNA Technology for the nonscience major.
Historical Perspective • Pre-history before 1928 • Ancient before 1944 • Medieval 1944 -1952 • Renaissance 1953 -1971 • Modern Era 1971 to present
Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known for a long time how to chop DNA into small pieces. What geneticists did not know how to do until the early 1970 s was to replicate small fragments of DNA.
1970 s Breakthrough: • The discovery of the restriction enzyme (or restriction endonuclease).
Properties of RE: • Cut double-stranded DNA at specific target sites. • Allow fragments of DNA that have been cut with the same RE to be rejoined.
Properties of RE con’t: • There are hundreds of popular RE. They all recognize a small target sequence (4 -8 b. p. ).
The joining of two DNA fragments by DNA ligase produces a recombinant DNA molecule
Therefore, eukaryotic DNA could be propagated in prokaryotic cells. A great breakthrough!!!!! •
Carriers of foreign DNA are Vectors: • Most vectors are derived from: • 1. Plasmids • 2. Bacteriophages • 3. Cosmids (artificial constructions)
• • A prokaryotic vector should: 1. Be capable of autonomous replication independent of the main bacterial chromosome 2. Be easy to isolate, i. e. small. 3. Be non-toxic to host cells. 4. Have space foreign inserts. 5. Have unique restriction sites for common restriction enzymes. 6. Have convenient markers for selection of transformants, e. g. antibiotic resistance genes. 7. Be relaxed, i. e. multiple copies in a host cell.
• A bacteriophage is a virus that infects a bacteria.
Introduction to PCR • PCR (polymerase chain reaction). * p r c
What is PCR? • PCR is site-specific in vitro DNA replication.
DNA Replication Review: • Add DNA polymerase, all 4 DNA building blocks ? ? ? 5’ CTGACGCTGCTGCATGCTAGCT 3’ 3’ GACTACGACGACGTACGATCGA 5’
DNA Replication Review: • Primers are required: 5’ CTGACGCTGCTGCATGCTAGCT 3’ CGA 5’ CTG 3’ GACTACGACGACGTACGATCGA 5’
DNA Replication Review: • Primers are required: 5’ CTGACGCTGCTGCATGCTAGCT 3’. . . t a c g a t CGA 5’ CTG a t g c t g. . 3’ GACTACGACGACGTACGATCGA 5’
Action of DNA Polymerases: • DNA polymerases can add new nucleotides to an exposed 3’ end!
PCR reaction mix: • • All 4 DNA building blocks (A, C, G, & T) Taq DNA polymerase (heat resistant) DNA to be replicated A pair of primers
Human Chromosome # 8: | | | | add primers: | | | Human Chromosome # 8: | | | | | | | | |
PCR product? • The binding of the primers determines where the DNA is replicated. • The PCR product is a double-stranded DNA molecule with its ends defined by the location of primer binding sites.
PCR • PCR reaction mix incubates for about 2 hours in a thermocycler (fancy incubator). • The thermocycler heats and cools through 30 -40 temperatures cycles.
• DNALC: PCR Animation
Two impt. PCR questions: • What is the source of a pair of primers? What information is a prerequisite for PCR?
PCR Applications: #1 - Cell-free rapid gene cloning!! #2 - Gene cloning/amplification from a miniscule sample size.
Introduction to Agarose Gel Electrophoresis
Weigh out ~ a gram of agarose.
• Mix the agarose with 50 - 100 ml of buffer.
• Heat to dissolve the agarose.
• Assemble the gel tray and comb.
Pour the gel.
• Pick up the DNA sample with a microliter pipettor.
• Load one DNA sample into each well on the gel.
Connect the gel to a low voltage power supply.
After completion of the run, add a DNA staining material and visualize the DNA under UV light.
• Analyze the results.
• Gel Electrophoresis
• Electrophoresis
Introduction to DNA Sequencing Technology
Dideoxy Sequencing (Sanger Sequencing, Chain Terminator method). • Clone the fragments to be sequenced into the virus M 13. • Why M 13? • The clones that are isolated are singlestranded DNA.
Primer ^^^ AGCATGATGTCGAGTCGTACGGT----- M 13
DNA sequencing reaction: 1) DNA fragment to be sequenced cloned into the vector M 13 2) DNA polymerase 3) “Universal” primer 4) All 4 DNA building blocks 5) One dd. NTP
The most popular technique is based on the dideoxynucleotide.
Set up 4 separate reactions. Each reaction contians one of the 4 dd. NTPs. Each dd. NTP is tagged with a radioactive tracer.
A reaction (with dd. A) 21, 26, 29, . . T reaction (with dd. T) 25, 31, 35, . . . C reaction (with dd. C) 22, 23, 27, . . G reaction (with dd. G) ? ? Primer (20 nt. ) ^^^ AGCATGATGTCGAGTCGTACGGT----- M 13
• Each reaction generates a set of unique fragment lengths. • All fragment lengths are represented. • None of the fragments are present in more than one reaction.
• DNA sequencing technology requires gel electrophoresis system with the ability to separate DNA fragments that separate by one b. p.
DNA sequencing, as performed in the 1980 s (manually) is slow and labor intensive. • NCBI Home. Page
• DNALC: Cycle Sequencing
• CE Theory
• A Timeline of The Human Genome • YEAR# human genes mapped to a definite chromosome location# years it would take to sequence the human genome • 1967 none sequencing not possible yet • 1977 3 genes mapped • 4, 000 years to finish at 1977 rate • 1987 12 genes mapped
• • Organisms sequenced Year # genomes sequenced 1994 0 1995 2 1996 4 1997 8 (est. ) 199830 (est. ) 2001 ~75
• DOE Joint Genome Institute
- Slides: 74