Real Time PCR FAM TAMRA Production at FIOCRUZ






















- Slides: 22
Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format.
Calibration System FAM Detection Sequence 5’ AGTATTCATCCACAATTTTAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAAT 3’ Calibration Sequence 5’ AGTATTCATCCACAATTTTAAAAGGGGGAAAAGGATTGGGGGGTACAGTGCAGGGGAAAGAAT 3’ VIC FAM HIV FAM HCV VIC VCA PET ou TAMRA
Results Calibrator FIOCRUZ - PATENT Standart curve
FIOCRUZ NAT Platform Bio-Manguinhos/IBMP • Extraction • HTP • LTP • PCR Setup • Detection
Liquid Microarrays for Diagnosis
Liquid Microarrays
Liquid Microarrays
Liquid Microarrays Reporter Fluorescence Green laser Bead Fluorescence Red laser
Pilot project multi-test
HCV Multitest – multitest typical result Internal Control Chagas Ag 1 HBV Ag 1 HCV Ag 2 14000 12000 HIV Ag 1 HIV Ag 2 HTLV Ag 1 10000 HTLV Ag 2 HTLV Ag 3 8000 HTLV 2 Ag 1 4 b 2 4 b 5 5 b 1 5 b 2 6 b 5 6 b 6 7 b 4 8 b 5 4000 8 b 6 9 b 1 10 b 2 10 b 3 11 b 2 11 b 6 14 b 5 2000 15 b 1 15 b 3 15 b 4 16 b 2 Pool 0 1 Internal Chagas HBVHCV Ag 1 HIV Ag 2 HIV Ag 1 Ag 2 HTLV 2 Syphilis 2 Control Ag 1 Ag 2 Ag 3 Ag 1 Ag 2 6000 Syphilis Ag 1 Syphilis Ag 2
7000 Syphilis - Antigen 1 6240 6216 6000 5417 4877 5000 5294 4922 4734 3703 4000 3691 3165 3000 2473 3252 3154 2586 2516 2369 2017 2000 1549 1441 1943 1574 1119 1000 291 7860 ff ut -o C Po o l 2 l 1 6 7964 7235 6890 7008 8 c 3 8 c 2 8 c 8 c 1 6 7 c 7 c 5 3 7 c 1 7 c 6 c 5 4 6 c 3 6 c 2 6 c 5 c Syphilis - Antigen 2 9230 9000 8000 Po o 9653 10000 6 5 5 c 5 c 2 1 5 c 4 c 6 4 4 c 3 4 c 4 c 2 0 7000 6201 6113 6000 5302 4933 4807 4806 5000 4216 4000 3274 3000 3411 3310 3311 2209 1642 3029 2512 2000 197 ff ut -o C 2 ol Po Po ol 1 6 8 c 3 8 c 2 8 c 1 8 c 6 7 c 5 7 c 3 7 c 1 7 c 5 6 c 4 6 c 3 6 c 2 6 c 6 5 c 5 5 c 2 5 c 1 5 c 6 4 c 4 4 c 3 4 c 4 c 2 0
HTLV - Antigen 1 18 000 16 000 13616 13189 14 000 12069 12 000 14214 11119 10168 9356 9198 10 000 Net MFI 8 000 12961 12363 11589 11224 10726 17025 16368 16193 8077 5778 6 000 3854 4 000 918 2 000 847 320 167 ff ut -o C l 2 Po o 16 a 2 Po ol 1 15 a 1 14 a 6 14 a 2 13 a 3 13 a 1 12 d 6 12 d 5 11 a 6 11 a 2 a 4 10 a 1 16 15 a 6 a 3 10 9 a 6 1 9 a 7 a 5 2 7 a 2 a 6 2 a 1 - HTLV - Antigen 2 25000 20268 19307 20000 17533 15205 13973 15000 Net MFI 10150 11377 13357 9192 10000 5000 11939 13140 11542 12772 7783 7041 4474 4630 3357 6224 1848 2679 249 166 ff ut -o C 2 ol 1 Po ol Po 16 a 2 15 a 1 14 a 6 14 a 2 13 a 3 13 a 1 12 d 6 12 d 5 11 a 6 11 a 2 10 a 4 16 a 1 15 a 6 10 a 3 9 a 6 9 a 1 7 a 5 7 a 2 2 a 6 2 a 1 0
25000 Chagas - Antigen 1 23424 21919 20516 19943 20192 19541 19977 19265 20000 18648 18316 17291 16077 15000 14600 11295 11685 10816 10731 10000 9009 8740 8730 5477 4883 5000 495 ff 2 ut -o C ol 1 Po ol Po 16 a 6 16 a 5 15 a 4 15 a 2 14 a 3 14 a 1 13 a 6 13 a 4 12 d 2 12 d 1 11 a 5 11 a 3 10 a 6 10 a 5 9 a 4 7 a 6 7 a 3 2 a 5 2 a 2 0
Different Trypanosoma cruzi antigen preparations
Trypanosoma cruzi ORFeome • 23, 083 “genes” (Gen. Bank, Jul 2009) • Highly redundant, estimated to be ~12, 000 distinct gene loci • Few gene families account for a large proportion of genes (6 families, 4967 “genes”, 21% of gene content) • The repetitive nature of the genome makes assembly difficult. As a consequence, the ORF definition is worse than for other organisms. • Related organisms, as Leishmania sp. and T. brucei, have about 8, 000 genes, which is a good estimation for the lower limit of T. cruzi genes.
Trypanosoma cruzi ORFeome Institute Carlos Chagas/FIOCRUZ ORFeome (Wikipedia) Orfeome is the totality of open reading frames(ORF) from one organism. ORFs are the most important genetic elements in genomes as they code for proteins Organism Genome (ORFs) ORFeome Suitable Vector (all ORFs in a suitable vector) (Gateway )
Trypanosoma cruzi ORFeome Institute Carlos Chagas/FIOCRUZ Pre-processing • Intense bioinformatics analysis, using all ORFs from Kinetoplastida genome projects, to better define the region to be amplified. • Primers are 30 mer in average, i. e. , US$6/gene 1 st step. PCR amplification 2 nd step. PCR purification 3 rd step. Gateway entry 2 PCRs per gene, US$3/gene Magnetic, US$1/gene BP reaction, US$5/gene 4 th step. Bacterial transformation, Colony picking and Culture Agar plates, 4 clones/gene, US$0. 25/gene 5 th step. Plasmid purification 6 th step. Plasmid verification Magnetic, US$1/gene PCR, US$ 0, 1/gene
Trypanosoma cruzi ORFeome ICC/FIOCRUZ Current state (v. 0. 2) • 3, 840 primer pairs designed and ordered. Completeness 40% • 1, 920 genes amplified (~85% of them were positive). 20% • ~7, 500 clones collected and certified by PCR. 20% Future prospects (6 months, v. 1. 0) • 7, 680 primer pairs designed and ordered. • Amplification of all analyzed genes. • All clones (~30, 000) collected and certified by PCR. • All clones sequenced and certified ORFeome produced. Future prospects (12 -18 months, v. 2. 0) • Information from other T. cruzi strain will be added and used for covering more ORFs that were excluded or not present in CL Brener.
Trypanosoma cruzi ORFeome Genome (ORFs) Organism Interactome Localizome Suitable Vector (Gateway ) HT protein expression Ag-Ab screening Downstream Applications ORFeome (among many others) (all ORFs in a suitable vector)
Antonio G. P. Ferreira Bio-Manguinhos-Fiocruz Bruna P. F. Fonseca, Bio-Manguinhos-Fiocruz Edimilson D. Silva, Bio-Manguinhos-Fiocruz Christiane F. S. Marques Bio-Manguinhos –Fiocruz Alexandre Costa IBMP Viviane Goes IBMP Cristiane Reinarch IBMP Cesar A. B. Duarte, ICC-Fiocruz Leonardo Foti ICC-Fiocruz Christian M. Probst ICC-Fiocruz Daniela Parada Pavoni ICC-Fiocruz Samuel Goldenberg, ICC-Fiocruz/IBMP Marco Aurelio Krieger ICC-Fiocruz/IBMP mkrieger@fiocruz. br