Protein Synthesis Translation The Ribosome Key Points Consists

Protein Synthesis: Translation

The Ribosome: Key Points • • Consists of 2 subunits Large Subunit (60 S) Small Subunit (40 S) m. RNA is clamped by the subunits

http: //www-tc. pbs. org/wgbh/nova/photo 51/images/pict-2001 ribosome. jpg

The Ribosome: Key Points • Ribosome moves toward the 3’ end of the m. RNA (5’ to 3’) direction • Reads codons and adds amino acids to a growing polypeptide chain • Reading Frame – determines the sequence in which the codons are read

5’ 3’ CAUGGCAUC • This is what the ribosome sees • It reads the m. RNA in codons in a 5’ to 3’ direction (the ribosome moves toward the 3’ end of the m. RNA molecule) • There are three possible “phases” the codons can be read

5’ Here And here 3’ CAUGGCAUC • There are three possible phases the codons can be read • This can lead to three completely different sequences! • Thus it is vital that the m. RNA is positioned correctly within the ribosome Why?

Try This! • The following is the sequence of the coding DNA strand in a prokaryote • Determine the sequence of the transcribed m. RNA • Then, using the Genetic Code on p 240, determine the polypeptide chain • How do you know where to start? 5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3’

t. RNA • Delivers the amino acids to the ribosome • How does a t. RNA know when to join the ribosome?

t. RNA • The anticodons of some t. RNAs recognize more than one codon • This is possible because the rules for base pairing between the third base of the codon and anticodon are relaxed (called the wobble hypothesis) – At the wobble position, U on the anticodon can bind with A or G in the third position of a codon • Why would this be beneficial?

The Wobble Hypothesis http: //www. mun. ca/biology/scarr/MGA 2 -03 -30. jpg • Ability of t. RNA to recognize 2 or 3 different m. RNA codons • The 3 rd base of the t. RNA anticodon “wobbles”, meaning that it can hydrogen bond with more than one type of base in the 3 rd position of the codon

Elongation (refer to Fig 4 on p 252) • After the start codon is recognized (AUG – methionine) the subsequent amino acids are added • The ribosome has two sites for t. RNA – A site (acceptor) – P site (peptide) • The “charged” t. RNA carrying the next amino acid in sequence enters the A site • Then the ribosome moves to the next codon and the “uncharged” t. RNA is moved to the P site (the exception to this rule is the start t. RNA with methionine that enters the P site directly) • A peptide bond forms between the amino acids and the uncharged t. RNA is recycled back to the cytoplasm

Translation Elongation • t. RNA translocates to allow a new t. RNA to bind to ribosomem. RNA complex http: //library. thinkquest. org/C 0123260/basic%20 knowledge/images/basic%20 knowledge/RNA/translation%20 steps. jpg

Termination (refer to Fig 4 e & f on p 252) • Once the stop codon (UGA, UAG, or UAA) is reached, the ribosome will come to a halt (there are no corresponding t. RNA’s) • Then, a protein release factor comes in to aid the release of the polypeptide chain from the ribosome • Translation of the gene of interest ends • Alterations may occur – read p 253

Homework • Read section 5. 4 which starts on page 250 • On page 254, do questions #1 -4, 6 -9, 10