Protein Synthesis Living Environment What are proteins Chains

Protein Synthesis Living Environment

What are proteins? Chains of Amino Acids connected to one another by peptide bonds. Review Have a specific shape and function. Examples: Enzymes Hormones Antibodies Hemoglobin

What is the difference between DNA & RNA?

The process of making proteins. What is Protein Synthesis ? Proteins make up everything in our bodies and control our physical characteristics. Example(s): proteins, enzymes, hormones, antibodies, and hemoglobin.

The building blocks of proteins: Amino Acids The building blocks… Protein function is determined by the shape and order/sequence of Amino Acids.

DNA’s job in protein synthesis… DNA’s job is to code for (make) a protein. DNA contains the instructions for making all proteins. Each gene in the DNA will code for a protein. ***** The order for the nitrogen bases in a strand of DNA will determine the Amino Acids order***

Protein Synthesis contains 3 steps… 1. Transcription (in the nucleus) 2. m. RNA strand leaves the nucleus 3. Translation (out of the nucleus)

The first step… This is when the DNA molecule “unzips” and a strand of m. RNA is created. 1. Transcription (in the nucleus) ***This happens in the nucleus!*** A U T A C G G C Example: DNA: T G C C G A A T C G A T m. RNA: A C G G C U U A G C U T

Transcription

DNA: ATC GCA AGC TAT RNA: Transcription practice… DNA: TAC TGG CGA ATC RNA:

Step 2 The m. RNA (messenger RNA ) leaves the nucleus and goes to the ribosomes.

Step 3 Translation (out of the nucleus) The m. RNA acts as a code that tells the t. RNA which Amino Acids to bring over. Codon: set of three Nitrogen bases Each codon “codes for” one Amino Acid

Circle the codon!

DNA original template strand: T G C C G A A T C G A T m. RNA strand: ACGGCUUAGCUA m. RNA broken up into codons: ACG/GCU/UAG/CUA

m. RNA broken up into codons: ACG/GCU/UAG/CUA Amino Acids: HOW? Write out the amino acids. . .

How do we read this chart? Steps: 1. Use the left side to find the first letter in the codon. 2. Use the top to find the second letter in the codon. 3. Use the right side to find the third letter of the codon. 4. Find where they match up.

What are start and stop codons? Start Codon: The first codon in the transcribed m. RNA that undergoes translation Stop Codon: These codons signal the end of the polypeptide chain during translation.

m. RNA broken up into codons: ACG/GCU/UAG/CUA Amino Acids: THR/ ALA/ STOP/ LEU Lets practice…

Example:

Overall…

DNA template strand: GAGTGTGTTGAACGATGCTCTACTCATCGTTGGGTT Demo m. RNA: CUCACACAACUUGCUACGAGAUGAGUAGCAACCCAA Codon: LEU/THR/GLN/LEU/ALA/THR/ARG/STOP/VAL/ALA/THR/ ILE