Protein Synthesis From DNA to Proteins The DNA

  • Slides: 12
Download presentation
Protein Synthesis

Protein Synthesis

From DNA to Proteins � The DNA strand is made of letters: ATGCTCGAATAAATGTCAATTTGA �

From DNA to Proteins � The DNA strand is made of letters: ATGCTCGAATAAATGTCAATTTGA � The letters make words: ATG CTC GAA TAA ATG TCA ATT TGA � The words make sentences: <ATG CTC GAA TAA> <ATG TCA ATT TGA> gene

Proteins � Genes instruct the cell to make proteins � Proteins enable a cell

Proteins � Genes instruct the cell to make proteins � Proteins enable a cell to perform special functions

PROTEIN SYNTHESIS DNA Transcription m. RNA Translation protein

PROTEIN SYNTHESIS DNA Transcription m. RNA Translation protein

TRANSCRIPTION � In the nucleus � Uses the RNA polymerase � DNA template strand

TRANSCRIPTION � In the nucleus � Uses the RNA polymerase � DNA template strand messenger RNA (m. RNA) � m. RNA uses Uracil (U) instead of Thymine (T) ◦ A and U ◦ C and G

http: //www. stolaf. edu/people/ giannini/flashanimat/molgenet ics/transcription. swf

http: //www. stolaf. edu/people/ giannini/flashanimat/molgenet ics/transcription. swf

TRANSLATION � At the ribosome � m. RNA Amino Acids � Codon = 3

TRANSLATION � At the ribosome � m. RNA Amino Acids � Codon = 3 nucleotides of m. RNA ◦ START CODON = AUG (methionine) ◦ STOP CODON = UAA, UAG, UGA � t. RNA brings the amino acid to the ribosome � Anticodon is complementary of the codon

USE m. RNA sequence!!

USE m. RNA sequence!!

Anticodon http: //www. stolaf. edu/people/gianni ni/flashanimat/molgenetics/translati on. swf

Anticodon http: //www. stolaf. edu/people/gianni ni/flashanimat/molgenetics/translati on. swf

Amino Acids Protein �A string of amino acids makes a polypeptide � One or

Amino Acids Protein �A string of amino acids makes a polypeptide � One or more polypeptides make a protein

Protein Synthesis Simulation 1. DNA Template 2. Make m. RNA Goes to Ribosome 3.

Protein Synthesis Simulation 1. DNA Template 2. Make m. RNA Goes to Ribosome 3. Organize m. RNA into codons 4. Find t. RNA anticodons 5. Using m. RNA, find amino acid 6. Amino Acids Protein