From DNA to Proteins � The DNA strand is made of letters: ATGCTCGAATAAATGTCAATTTGA � The letters make words: ATG CTC GAA TAA ATG TCA ATT TGA � The words make sentences: <ATG CTC GAA TAA> <ATG TCA ATT TGA> gene
Proteins � Genes instruct the cell to make proteins � Proteins enable a cell to perform special functions
PROTEIN SYNTHESIS DNA Transcription m. RNA Translation protein
TRANSCRIPTION � In the nucleus � Uses the RNA polymerase � DNA template strand messenger RNA (m. RNA) � m. RNA uses Uracil (U) instead of Thymine (T) ◦ A and U ◦ C and G
TRANSLATION � At the ribosome � m. RNA Amino Acids � Codon = 3 nucleotides of m. RNA ◦ START CODON = AUG (methionine) ◦ STOP CODON = UAA, UAG, UGA � t. RNA brings the amino acid to the ribosome � Anticodon is complementary of the codon
USE m. RNA sequence!!
Anticodon http: //www. stolaf. edu/people/gianni ni/flashanimat/molgenetics/translati on. swf
Amino Acids Protein �A string of amino acids makes a polypeptide � One or more polypeptides make a protein
Protein Synthesis Simulation 1. DNA Template 2. Make m. RNA Goes to Ribosome 3. Organize m. RNA into codons 4. Find t. RNA anticodons 5. Using m. RNA, find amino acid 6. Amino Acids Protein