Oral Care Probiotics Enhance Patients Oral Overall Health
Oral Care Probiotics Enhance Patients’ Oral & Overall Health Developed by Martin Handfield, M. Sc. , Ph. D Contributions by Joleyn Carriveau RDH, BS, PDHC
Course Objectives • • • Provide the learner with the history, origin, science and mechanism of oral probiotics. Understand how oral probiotics work to repopulate healthy bacteria and overtake pathogenic bacteria. Provide the dental team with • The benefits and solutions for at risk patients susceptible to periodontal problems and tooth decay. • The benefits of daily and continued use of probiotics in adequate dosages and how this leads to better patient outcomes. 1
Learning Outcomes • Learn the history and science of oral care probiotics • Understand the difference between oral and digestive probiotics • Present 3 different strains of oral probiotics and the mechanism in periodontal stability and reducing tooth decay • Learn the benefits of healthy bacterial strains in probiotics and how they will enhance and prolong your patients oral health 2
Learning Outcomes Continued… • Learn how oral care probiotics work symbiotically with other treatment procedures • Learn how to recommend and implement the use of oral care probiotics into your practice to achieve successful stable results • Recognize how oral care probiotics lead to better patient outcomes 3
Course Introduction • • • Today, dental and medical professionals are focused on helping their patients realize that a healthy body, begins with a healthy mouth. In our fast-paced world, everyone wants a simple natural way to achieve good health. Safe and easy use of oral care probiotics bring a powerful non-drug alternative to dentistry. Years of research, resulted in a proprietary blend that contains the correct dosage of three naturally occurring strains of beneficial bacteria • Streptococcus Oralis KJ 3® • Streptococcus Uberis KJ 2® • Streptococcus Rattus JH 145® Continued use of this unique tri-blend of naturally occurring bacteria aide in restoration of a healthy mouth. 4
Course Introduction Continued… • Oral Care Probiotics • Restore the balance of beneficial bacteria in a persons’ mouth. • Are live dormant bacteria that are identical to the beneficial microorganisms found innately in your mouth. • Can be beneficial to ones overall health. • Often times healthy bacteria are depleted by diet, stress, medication or illness and need to be replaced to restore health. • Including probiotics in a daily oral care regimen • Constantly reinforces the healthy bacteria in your mouth • Crowd out the unhealthy bacteria including those that produce bad breath. • Supports tooth and gum health, whiter teeth and fresher breath • Easy to incorporate this quick step into their daily oral bedtime routine. • The Course will cover the history, science and evidence based research behind oral care probiotics. • Explore the concept of replacement therapy to help your patients to improve their oral and overall health. 5
Disclosure Statement • The content in this self-study course was developed by Martin Handfield, M. Sc. , Ph. D. He serves as Oragenics Vice President and former scientist and researcher of their products. He is a advisor and consultant for, Pro. Biora Health™. • This course was designed and developed on behalf of Pro. Biora Health, Inc. • The purchase of Pro. Biora. Pro® product line from Oragenics, Inc. to bring Pro. Biora. Pro based products to market. • Contributions by Joleyn A Carriveau RDH, BS, PDHC, as part of a consulting agreement with Pro. Biora Health, LLC.
Probiotics Definition Probiotic literally means “for life” "Live microorganisms which, when administered in adequate amounts, confer a health benefit on the host” Paradigm shift: from curative care… to preventive care Source: Report of a Joint FAO/WHO Expert Consultation on Evaluation of Health and Nutritional Properties of Probiotics in Food Including Powder Milk with Live Lactic Acid Bacteria (October 2001)
Probiotics Definition Probiotics… live bacteria in adequate amounts Prebiotics… are non-digestible food ingredients that stimulate the growth and/or activity of bacteria in the digestive system in ways claimed to be beneficial to health Symbiotics… prebiotic + probiotic
Probiotics – Historical Perspective 77 AD: Roman literature reports that fermented food were used as therapeutic agents Marco Polo (1254 -1324) mentions Kefir in recounting his travels… Pliny the Elder or Gaius Plinius Secundus Source: Wikipedia
Probiotics – “Manipulate the microbiota to prevent or treat infections” 1852: Mosse uses yeasts in the treatment of boils 1877: Pasteur and Joubert note that the growth of the anthrax bacilli in co-culture with “common bacilli” was suppressed 1907: Metchnikoff suggested that it would be possible to modify the gut flora and to replace harmful microbes with useful microbes (bacterial interference therapy or bacterio-therapy) 1920: Rettger demonstrate that Metchnikoff’s Bacillus could not live in the human GI tract, disputing his theory 1930’s: Shirota investigates the causal relationship between bacteria and good intestinal health. He invents Yakult in 1935 1953: Kollath is credited with the introduction of the term “probiotics” Nobel Laureate Élie Metchnikoff (1845 -1916) Source: Wikipedia
Probiotics – Legal Definition Although a consensus scientific definition has been advanced, no legal definition of the term “probiotic” exists The term unfortunately can be (and is) used on products that do not meet the minimum criteria of a probiotic: • be shown to be efficacious in controlled human studies • be delivered in adequate dose (through the end of shelf life) • be alive FAO 2002. Guidelines for the evaluation of probiotics in food. www. fermented-foods. net/wgreport 2. pdf
Difference: oral and gastrointestinal probiotics “Is there a difference between the Oral and GI microflora? ” Part of a continuous alimentary tract, BUT: • Different core microbiome (collection of genes) • Environment (p. H, e. H, nutrients, etc…) • Attachment sites (tissue tropism) • Dynamic • 30 -50% still cannot be cultivated! Chen, Dewhirst, Fouts, Izard, Paster, Tanner, Wade et al. YES GIT 300 -1000 species UT 200+ species Skin Oral 50+ species 800+ species
Towards a rational oral probiotic design: • Should adhere and colonize the teeth and/or periodontal tissue • Should become part of the biofilm • Should not ferment sugar • Should exert its effect through a known mechanism • Should be live • Should be delivered in adequate dose (through the end of shelf life) • Should be efficacious in controlled human studies
How do oral probiotics work? Three theoretical mechanisms of ORAL probiotic action: 1. 2. 3. Enhancement of mucosal barrier function Immune modulation Competitive Exclusion • • Antimicrobial production Production of metabolic by-products Hindering adhesion sites Competition for nutrients Reviewed by O’Toole and Cooney, 2008 Reviewed by Teughels, 2008
Tropism of Probiotics The internationally endorsed definition of probiotics is live microorganisms that, when administered in adequate amounts, confer a health benefit on the host. Digestive Lactobacillus reuteri, Lactobacillus brevis, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus salivarius Throat and Sinus Pro. Biora 3 Streptococcus rattus JH 145® Streptococcus oralis KJ 3 ® & Streptococcus uberis KJ 12 ® Blis K 12/ M 18 Streptococcus salivarius
Oral Probiotics Bacterial Strains in Commercial Products TEETH & GUMS Streptococcus oralis Streptococcus uberis Streptococcus rattus GUT SALIVA/THROAT BLIS K 12 & M 18 (Streptococcus salivarius) SALIVA/THROAT & GUT Lactobacillus reuteri Lactobacillus brevis, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus salivarius BLIS K 12 & M 18 (Streptococcus salivarius) Lactobacillus reuteri
Pro. Biora 3 – Overview • Patented blend of three probiotic strains native to the biofilm of teeth and gums Streptococcus oralis Streptococcus uberis Streptococcus rattus • First and only comprehensive oral care probiotic offered in market, 2009 • Strong scientific basis for safety and efficacy GRAS Notice (GRN) No. 591. Backed by 35 years of research http: //www. fda. gov/Food/Ingredients. Packaging. Labeling/GRAS/Notice. In ventory/default. htm
Patented Probiotic Ingredient Blend S. oralis KJ 3® S. uberis KJ 2® PERIODONTAL HEALTH Pro. Biora 3 S. rattus JH 145® DENTAL HEALTH
Our Story: The Origins of Oral Care Probiotics Hillman’s Hypothesis: • If everyone has detrimental bacteria in their mouths, why doesn’t everyone have serious tooth decay and periodontal disease? • What is balancing the impact of these detrimental bacteria? Hillman’s Discovery: • Beneficial bacteria exist in healthy dental plaque! 1 2 3 4 Johnson/Gross/Hillman, Archives of Oral Biology, Vol 25 pp 707 – 713, 1980 Hillman/ Socransky, Archives of Oral Biology, Vol 27 pp 75 -77, 1982 Hillman/Socransky/Shivers Archives of Oral Biology, Vol 30, No 11/12, pp 791 -795, 1985 Hillman/Andrews/Dzuback, Infection and Immunity, June 1987, American Society for Microbiology Dr. Jeff Hillman, DMD, Ph. D 5 6 7 8 Hillman/Socransky, New Biotechnology in Oral Research, 1989 Socransky/Haffajee, Dzink/Hillman, Oral Microbiol Immunol, 1988: 3: 1 -7 Hillman/Shivers, Archives of Oral Biology, Vol 33, No. 6, pp 395 -401, 1988 Hillman/JD/Hillman CH/Mc. Donald/Zahradnik/Madhu, International Journal of Toxicology/ Vol 28, No 5, 2009 19
Dr. Hillman’s Discovery: If everyone has pathogenic bacteria in their mouth, why doesn’t everyone have rampant tooth decay and periodontal disease? Discovery: Beneficial bacteria exist in healthy dental plaque.
First Challenge: Periodontal Diseases ● Three out of four American adults have some form of periodontal disease ● Periodontal disease causes over 70% of tooth loss in adults over the age of 35 ● The American Dental Association has estimated the spending on professional periodontal treatment to be nearly $12 billion per year Simplyteeth. com
The Problem: Periodontal Diseases Very difficult to study ● 700 species of bacteria in the oral cavity ● Not all cultivable ● Variety of mechanisms ● Difficulty: substantiate claims prior to clinical study using in vitro tests and animal models 20 years of “Predominant Cultivable Microbiology” ● Compare healthy vs. disease plaque and look for blooms ● 6 -8 likely pathogens, but not all are “prime movers”
Periodontal Strains S. uberis KJ 2 & S. oralis KJ 3 Rationale and Mechanism of Action Diseased Tooth/Gum Healthy Tooth/Gum Streptococcus oralis KJ 3® & Streptococcus uberis KJ 2® Three lines of evidence: 1. Laboratory studies on beneficial bacterial species present in healthy dental plaque 2. 3. Database mining Periodontal Pocket Re-colonization studies in animal models and humans Gingivae (Gums) Inflammation
S. uberis & oralis: Rationale and MOA (KJ 2 -KJ 3) Localized Aggressive Periodontitis (LAP) • Acute loss of bone surrounding anterior teeth and 1 st molars • Onset at puberty • Familial tendency • Various lines of evidence implicate Aggregatibacter (Actinobacillus) actinomycetemcomitans (Aa) as the principal etiologic agent
S. uberis & oralis: Rationale & Mechanism of Action MOA Percentage of Isolates Inhibitory to Aa Hillman and Socransky, 1982
S. uberis & oralis: Rationale & Mechanism of Action MOA Percentage of Inhibitory Isolates in an LAP family Hillman and Socransky, 1982 Motherly. com
S. uberis & oralis: Rationale & Mechanism of Action MOA SAMPLE PLAQUE FROM A PERIODONTAL SITE DISPERSE IN BUFFER AND SPREAD SAMPLES ON NON-SELECTIVE MEDIUM INCUBATE CROSS-STREAK SAMPLE OF Aa CULTURE ON FRESH PLATE . . STAB INDIVIDUAL COLONIES INTO PLATE COVERED WITH Aa CULTURES INCUBATE Hillman and Socransky, 1982
Repopulate and Replenish Healthy Bacteria HEALTHY PLAQUE DISEASE PLAQUE MICROORGANISM PERCENTAGE OF INHIBITORS Streptococcus oralis Streptococcus uberis Other 98 1 1 Hillman and Socransky, 1982
CDC: Prevalence Periodontal Disease
S. uberis & oralis: Rationale and MOA (KJ 2 -KJ 3) • The mechanism of inhibition by S. oralis is production of hydrogen peroxide • Catalase studies • Mutant analysis • Normal end-product of aerobic metabolism Hillman and Shivers, 1988
S. uberis & oralis: Rationale and MOA (KJ 2 -KJ 3) S. oralis Interacts with Aa in Gnotobiotic Rats When Streptococcus oralis is present, Aa is inhibited Hillman and Shivers, 1988
S. uberis & oralis: Rationale and MOA (KJ 2 -KJ 3) Second Line of Evidence: Database Mining EFFECTOR SPECIES TARGET SPECIES (PATHOGENS) B. forsythus Aa P. gingivalis P. intermedia P. micros C. rectus P. mel. S. oralis 1. 01 0. 41 0. 38 1. 21 0. 42 0. 28 0. 86 S. uberis 0. 18 0. 81 0. 68 0. 12 0. 30 0. 20 S. intermedius 0. 31 0. 99 2. 17 1. 46 0. 78 0. 69 0. 74 S. mitis 3. 78 0. 59 0. 91 1. 69 0. 32 1. 93 Red, Negative association with an average odds ratio < 0. 5 Green, Positive association with an average odds ratio > 2. 0 Results are from a total of 275 samples from 35 subjects (13, 750 isolates) Socransky et al. , 1988
S. uberis & oralis: Rationale and MOA (KJ 2 -KJ 3) In Vivo Inhibition Is Dose Dependent Odds ratio 1. 0 A. actinomycetemcomitans 0. 5 0 >0 >2 >4 >6 >8 % S. oralis in site The higher the dose of S. oralis the less Aa is present. Hillman et al. , 1985
S. uberis & oralis: Rationale and MOA (KJ 2 -KJ 3) Third Line of Evidence: Recolonization Studies • Treated periodontal lesions that are recolonized by certain viridans streptococci are much more likely to remain free of further disease than are sites that do not get recolonized • Haffajee et al. , J Clin Periodontol, 1984 Oct; 11(9): 600 -18 • Teughels et al. , J Dent Res, 2007 Nov; 86(11): 1078 -82 • Nackaert et al. , J Clin Periodontol, 2008 Dec; 35(12): 1048 -52 • Teughels et al. , J Clin Periodontol, 2011 Mar; 38 Suppl 11: 159 -77
Second Challenge: Tooth Decay Size of market • Tooth decay is the most prevalent chronic infectious disease affecting more than 90% of the worldwide population • US Stats • 42% Ages 2 -11 • 59% Ages 12 -19 • 92% Ages 20 -64 • 93% of Seniors 65+be alive 1 https: //www. nidcr. nih. gov/research/data-statistics/dental-caries/seniors | 2 Laleman I, Detailleur V, Slot DE, Slomka V, Quirynen M, Teughels W. J: Clin Oral Invest (2014) 18: 1539– 1552
S. rattus: Rationale and MOA (JH 145) Tooth Decay • There is a very large body of literature that implicates S. mutans as the principle etiologic agent of tooth decay • Lactic acid is made by S. mutans from metabolism of dietary sugar. The acid is trapped against the tooth surface by a dextran capsule, which promotes dissolution of mineral in enamel and dentine www. sciencephoto. com www. aquafreshscienceacademy. com
S. rattus: Rationale and MOA (JH 145) S. rattus JH 145 is a naturally occurring mutans streptococcus strain that does not make lactic acid. JH 145 parent gctgttggagacgctcttgaccttagccatgcacttgccttcaccaaagaaaatt |||||||||||||||||||||||||||||| gctgttggagacgctcttgaccttagccatgcacttgccttcaccaaagaaaatt JH 145 parent tacgctgctaaatatgaagactgtgcggatgctg-ccttgttgtcattactgcaggtgca ||||||||||||||||| tacgctgctaaatatgaagactgtgcggatgctgaccttgttgtcattactgcaggtgca cctcaaaaaccaggtgaaactcgtcttgaccttgtcggtaaaaaccttgcaatcaacaaa |||||||||||||||||||||||||||||| cctcaaaaaccaggtgaaactcgtcttgaccttgtcggtaaaaaccttgcaatcaacaaa LACTATE DEHYDROGENASE GENE SEQUENCE Hillman et al. , J Appl Microbiol. 2009 Nov; 107(5): 1551 -8.
S. rattus: Rationale and MOA (JH 145) Cariogenicity of Parent and Mutant Strains • Rat infected with acidproducing wild-type strain • Rat infected with JH 145 www. sciencephoto. com Hillman et al. , J Appl Microbiol. 2009 Nov; 107(5): 1551 -8.
Proportion of NG 8 to Total Bacteria (%) S. rattus: Rationale and MOA (JH 145) PROOF OF PRINCIPLE: EFFECTS OF DAILY JH 145 TREATMENT ON COLONIZATION BY DISEASE-CAUSING S. MUTANS 0. 9 0. 8 0. 7 0. 6 0. 5 0. 4 0. 3 0. 2 0. 1 0 START 5 STOP 10 15 20 25 30 35 Time (Weeks) Control JH 145 Treated Hillman et al. , J Appl Microbiol. 2009 Nov; 107(5): 1551 -8. www. sciencephoto. com
Patented Probiotic Ingredient Blend S. oralis KJ 3® S. uberis KJ 2® PERIODONTAL HEALTH Pro. Biora 3 S. rattus JH 145® DENTAL HEALTH
Pro. Biora 3 – Early Published Study Results 1. Safe: No treatment related adverse events in: • 14 week rat study (109 cfu/day) • Two independent 4 week human studies (2 x 106 and 2 x 108 CFU/day) 2. Can be killed: All three strains are sensitive to all front-line antibiotics 3. Reversion frequency unmeasurably low for JH 145 (ldh) Safety assessment of Pro. Biora 3, a probiotic mouthwash: subchronic toxicity study in rats. Hillman JD, Mc. Donell E, Hillman CH, Zahradnik RT, Soni MG. Int J Toxicol. 2009 Sep-Oct; 28(5): 357 -67. Preliminary assessment of safety and effectiveness in humans of Pro. Biora 3, a probiotic mouthwash. Zahradnik RT, Magnusson I, Walker C, Mc. Donell E, Hillman CH, Hillman JD. J Appl Microbiol. 2009 Aug; 107(2): 682 -90. Epub 2009 Mar 30.
Pro. Biora 3 - Confirming Published Study Results Duration: 4 weeks • S. mutans reduced 6 -fold • 2 periodontal pathogens reduced 400 - and 100 -fold *One of 11 subjects was dropped as non-complier/non-responder. †Used only last two visits (allowed time for treatment effect). ‡Used only last two visits; dropped two of 11 non-compliers/non-responders and one of 11 with non P. gingivalis at baseline. Preliminary assessment of safety and effectiveness in humans of Pro. Biora 3, a probiotic mouthwash. Zahradnik RT, Magnusson I, Walker C, Mc. Donell E, Hillman CH, Hillman JD. J Appl Microbiol. 2009 Aug; 107(2): 682 -90. Epub 2009 Mar 30.
Pro. Biora 3 – Whitening Published Study Results Hydrogen peroxide production by Pro. Biora 3 strains also provides a whitening effect Average of treated control Tea and chlorhexidine-stained ceramic chips treated with Pro. Biora 3® or untreated 4 Weeks = Average Whitening was 2 -3 Shades
Case Study Results Source: Dr. Alan Slootsky, DMD. Other Cosmetic Benefits: Fresher Breath Fresher breath from interference with certain periodontal pathogens known to be important in production of volatile sulfur-containing compounds
Twetman Study Design • Duration 1 year • 138 healthy 2 -3 -year-old children • Double-blind placebo-controlled design • Half given Evora. Kids • with Pro. Biora 3 • Multi-cultural • Low socio-economic
Twetman Study Results • • No side effects reported The first Clinical study that demonstrated a significant reduction of early childhood caries following daily intake of oral probiotic tablets. The carries increment was significantly lower in test group compared with placebo group p<0. 05 The risk reduction was 0. 47 (95% confidence interval) • No differences were displayed between the groups in visible plaque and bleeding-on-brushing
Cannon Clinical Study Design Determine the effect of "over the counter" oral care probiotic on the Caries Risk in high caries risk children. • • • Sixty subjects 6 to 12 years old with high caries risk Evaluated by the difference in the salivary levels mutans streptococci and Lactobacilli Group A used Perio. Balance lozenges for 28 days. Group B used the Evora(Pro. Biora)Kids probiotics chewable mints - 30 days. Salivary samples incubated for 48 hours for colony counting and ranking. Follow up testing with the CRT was performed after 60 days
Cannon Study: Conclusion • Caries prone children significantly affected by probiotic use. • Both Pro. Biora(Evora)Kids and Perio. Balance significantly decreasing the number of S. mutans and lactobacilli present in the salivary samples. Statistically significant difference in the CRT results between the pre and post use of the probiotics. • Perio. Balance; SM results t= -6. 78 p<. 0001 Lactobacilli results t= -5. 762, p<. 0001, • Evora(Pro. Biora)Kids SM results t= -7. 33, p<. 0001, Lactobacilli results t= -2. 952, p=. 0068.
Oral Probiotics – Shift in Paradigm • In healthy patients: • continue to brush and floss!!! • maintain and promote a healthy biofilm • In non-compliant or institutionalized patients, • the young, the elderly, etc. (anyone unable to brush, caution: if choking is an issue ground up the mint) • In diseased patients, the paradigm is shifting to proactive care: • probiotics are complimentary to most therapies • conventional therapy (SRP, Tx, CHX, …) • as an adjunct to Tx to restore/promote a healthy flora • halitosis • tooth decay • gingivitis or periodontitis
Pro. Biora 3 – Safe & Effective For All Patients! 1 Robert P. Allaker & Abish S. Stephen: Curr Oral Health Rep October 2017 2 Laleman I, Detailleur V, Slot DE, Slomka V, Quirynen M, Teughels W. J: Clin Oral Invest (2014) 18: 1539– 1552 3 Laleman I, Teughels W. QQuintessence International VOLUME 46 • NUMBER 3 • MARCH 2015
Protocol for Daily Oral Health Maintenance • Start after cleaning, treatment, or anytime to maintain a healthy oral microbiome. • Dissolve the mint in the mouth once per day. • Preferably in the evening before bedtime, to allow longer colonization time while sleeping. • If using mouth rinse, wait 30 minutes • If daytime, wait 30 minutes to eat or drink • Continue to use continuously to maintain healthy teeth, gums, fresh breath and whiter teeth.
Pro. Biora 3 – Follow up to Therapies Most dental treatments strive to kill or reduce all bacteria in the mouth. Appliance give pathogenic bacteria new environments. Follow-up & regular use of probiotics logically repopulates the beneficial bacteria Daily Preventative Care Post Hygiene visit Halitosis/Bad Breath Antibiotics Pregnant woman Geriatric Pediatric TMJ appliances Sleep apnea appliances Orthodontics Laser treatment Ozone therapy Periodontal treatments Implants Oral Surgery Diabetic/Epileptic patients Patients with medications Note: if chocking risk, grind up the mint
Treatments that probiotics compliment • Fluoride Varnish: A concentrated fluoride which is applied to the tooth surface, enamel, dentin or cementum. Adheres temporarily to prevent tooth decay, remineralize tooth surfaces and treat dentinal hypersensitivity. • Scaling & Root Planning: Periodontal, non-surgical procedure to treat gum disease • Carifree: neutralizes decay-causing acids and fixes your decay problem at its source. At home procedure taken over any given amount of time. • Perio Protect: The Perio Tray is able to reach deep into the pockets between the teeth and gums, applying medication to infected gum tissue. At home procedure taken over any given amount of time. • Arestin: is a concentrated, locally applied antibiotic that remains active in the pocket for an extended period of time to reduce pocket depth and hypersensitivity. • Many Others Using Pro. Biora 3 probiotics as an adjunct with these treatments & products will only enhance and extend the benefits of these products.
Option 1: How It Works – As Easy as 1, 2, 3 Oral Care Probiotics are easy to use – Just one mint per day You can take at any time of day and achieve results, but taking at bedtime is more effective! Let mint dissolve on your tongue Notice healthier teeth and gums, whiter teeth and fresher breath in as little as 30 days Best Practices Keep Bottle closed at all times. Do not remove the desiccant pack from bottle. Store in a cool, dry place. Avoid exposure to heat and humidity. Effective to use with dental appliances and sleep aids. If using mouthwash, wait 30 minutes after you rinse before taking oral care probiotic.
Oral Probiotics – Precautions and Contradictions • Consult a physician before using oral probiotics if you are: • immuno-compromised • immuno-suppressed • immuno-deficient • have any underlying medical condition • During the course of an antibiotic regimen • no danger • most benefit
Correlations: Oral Health and Systemic Health • Heart Disease • High blood pressure • Stroke • Head & neck cancer • Diabetes • Alzheimer’s disease • Pancreatic and kidney Cancer • Rheumatoid arthritis • Pregnancy Health
A Healthy Body, Starts with a Healthy Mouth
THANK YOU FOR COMPLETING THE PROBIORA HEALTH Oral Care Probiotic Self Study Course Go to the next slide to complete the test and receive 1. 5 CE Credits
To Receive 1. 5 CE Credits… The educational part of your CE Course is complete. To learn more about Pro. Biora. Pro… the best most comprehensive oral care probiotic available…continue on with presentation If you want to learn more about oral care probiotics click here If you want to place an order for your office, use Promotional Code* PROCELL 10 to save on your first order. ORDER NOW *Valid on 1 -3 cases (12 bottles/case) Click here to complete the post test for 1. 5 credits: * Must achieve 80% pass rate for 1. 5 CE’s
• • • Extra-strength blend of Pro. Biora 3® crowds out harmful bacteria around teeth and gums Use once daily Extends the benefits of a dental hygiene visit Suggested Retail Price $59. 95 90 -day supply Distributed exclusively by dental & medical professionals! If you want to place an order for your office, use 10% off Promotional Code* PROCELL 10 your first order. ORDER NOW *Valid on 1 -3 cases (12 bottles/case)
Pro. Biora. Pro – How It Works – As Easy as 1, 2, 3 Pro. Biora. Pro is easy to use – Just one mint per day You can take Pro. Biora. Pro at any time of day and achieve results, but taking at bedtime is more effective! Let Pro. Biora. Pro dissolve on your tongue Notice healthier teeth and gums, whiter teeth and fresher breath in as little as 30 days Pro. Biora. Pro Best Practices Keep Bottle closed at all times. Do not remove the desiccant pack from bottle. Store in a cool, dry place. Avoid exposure to heat and humidity. Effective to use with dental appliances and sleep aids. If using mouthwash, wait 30 minutes after you rinse before taking Pro. Biora. Pro
Pro. Biora. Pro - Features and Benefits ü Backed by more than 30 years of research ü Promotes healthy bacterial balance in mouth ü Safe for daily use and active in the support of gum and tooth health ü Will not harm enamel or dental prosthesis of any kind ü Easy-to-use, dissolvable mint ü Naturally whitens teeth and freshens breath ü 100% natural ü Store in a cool, dry location ü Soy-, wheat-, nut-, and gluten-free
What Makes Pro. Biora. Pro the Best Oral Probiotic Available… • Patented blend of three probiotic strains native to the biofilm of teeth and gums Streptococcus oralis Streptococcus uberis Streptococcus rattus • First and only comprehensive oral care probiotic offered in market, 2009 • Strong scientific basis for safety and efficacy GRAS Notice (GRN) No. 591. http: //www. fda. gov/Food/Ingredients. Packaging. Labeling/GRAS/ Notice. Inventory/default. htm
GRAS Status Generally Recognized As Safe • Safe for use: considered food ingredient • Patented blend of three probiotic strains • Native to the biofilm of teeth and gums – Streptococcus oralis KJ 3® – Streptococcus uberis KJ 2® – Streptococcus rattus JH 145® First and only comprehensive oral care probiotic offered in market, 2008 GRAS Notice (GRN) No. 591. http: //www. fda. gov/Food/Ingredients. Packaging. Labeling/GRAS/Notice. Inventory/default. htm
Contact Information… If you want to learn more about oral care probiotics click here If you want to place an order for your office, use Promotional Code* PROCELL 10 to save on your first order. ORDER NOW For more information call 800 -983 -6908 Ext 1 *Valid on 1 -3 cases (12 bottles/case)
Option 1: How It Works – As Easy as 1, 2, 3 Oral Care Probiotics are easy to use – Just one mint per day You can take at any time of day and achieve results, but taking at bedtime is more effective! Let mint dissolve on your tongue Notice healthier teeth and gums, whiter teeth and fresher breath in as little as 30 days Best Practices Keep Bottle closed at all times. Do not remove the desiccant pack from bottle. Store in a cool, dry place. Avoid exposure to heat and humidity. Effective to use with dental appliances and sleep aids. If using mouthwash, wait 30 minutes after you rinse before taking oral care probiotic.
- Slides: 67