Nucleic Acids DNA Replication Protein Synthesis What are

Nucleic Acids, DNA Replication & Protein Synthesis

What are Nucleic Acids? Biochemical group containing molecules DNA and RNA Composed of the elements C, H, O, N, P Function: Store Genetic Information

DNA (Deoxyribonucleic Acid) Where is the DNA found in the cell? Nucleus

What is DNA made of? Monomers called Nucleotides have 3 parts: 5 Carbon Sugar; Deoxyribose Nitrogenous base Phosphate group

NUCLEOTIDES Named for the Nitrogenous base it contains Looks like: Deoxyribose----Thymine | phosphate THIS IS A THYMINE NUCLEOTIDE

Nitrogenous base (A, G, C, or T) Phosphate group Thymine (T) Sugar (deoxyribose)

4 Different Bases Thymine (T) Cytosine (C) Pyrimidines Guanine (G) Adenine (A) Purines

HOW do DNA & RNA form polymers (polynucleotides)? A covalent bond forms between the sugar of 1 nucleotide and the phosphate of the next nucleotide. This forms the sugar-phosphate backbone Nitrogenous bases extend from the sugar-phosphate backbone Copyright © 2009 Pearson Education, Inc.

Sugar-phosphate backbone Phosphate group Nitrogenous base Sugar Nitrogenous base (A, G, C, or T) DNA nucleotide Phosphate group Thymine (T) Sugar (deoxyribose) DNA nucleotide DNA polynucleotide

Sugar-Phosphate Backbone of DNA Polymer This STRONG, backbone of the DNA strand (polymer) forms the “sides” of the ds DNA ladder These bonds are DIFFICULT to break!! WHY is that important? ?

But DNA is double stranded- How are the 2 DNA strands held together? SPECIFIC pairing of nitrogenous bases by hydrogen bonds! The “steps” of the ladder are the same distance across- ALWAYS a purine (2 ring) with a pyrimidine (1 ring) nucleotide

This is called Complementary Base Pairing: Adenine –Thymine (A-T) Cytosine-Guanine (C-G)

This specific pairing of bases gives the double helix a uniform shape: – A pairs with T by 2 hydrogen bonds – G pairs with C by 3 hydrogen bonds

Structure of DNA Two polynucleotides joined by hydrogen bonding between bases twists into helical shape Looks like a Spiral staircase! Copyright © 2009 Pearson Education, Inc.

As an organism grows, what happens to the cells? They need to divide- 1 goes to 2; 2 go to 4 …. . What has to happen BEFORE division? All the DNA has to be copied so the “daughter” cells will contain all the genetic information in the parent cell.

What is the process? DNA replication During replication, each strand is used as a template (pattern) to produce a complementary strand using specific base pairing – Each new DNA helix has one old strand with one new strand – Example: ACGCAATTGCATT – The complement strand TGCGTTAACGTAA Copyright © 2009 Pearson Education, Inc.

HOW does Replication happen? DNA strands separate at the ‘origin’ & the DNA ‘unzips’ Enzymes (including DNA polymerase) match free nucleotides to each ‘parent strand’ & bond them to the backbone of the newly synthesized strand.

Initiation of Replication

Replication is Semi-conservative! Replication results in 2 double stranded molecules, each containing one parent strand one new strand.

Semi-Conservative Replication. Each new ‘Daughter’ DNA has 1 copy of parent DNA (dk blue) and one new strand of DNA (light blue).

Summary: DNA replication results in 2 identical copies of ds DNA from 1 original. Each ‘daughter’ DNA contains 1 ‘parent’ strand 1 ‘new’ strand Because base pairing is always complementary (A-T; G-C), replication enzymes can use BOTH parent strands as templates.

Fill in the Newly synthesized Strand. A T C G T G G C T A ATTGGCC…. T ….

What structure does DNA form inside cells? Chromosomes! The DNA wraps around proteins which allows ALL of it to fit in the nucleus DNA from 1 cell is 6 -1/2 FEET long!!! Our cells have 23 different pairs of chromosomes; (46 total chromosomes) These store ALL the genetic information to make YOU!!!!

What is the role of DNA? Store ALL the genetic information What is genetic information? ? Gene – sequence of DNA containing the information to make a protein. How is the information stored? - The order (sequence)of the DNA bases (A, C, G, T)!!

Genes, cont… A gene is usually thousands of bases long! The DNA in a single human cell = 3, 000, 000 (3 billion) base pairs However, scientists were surprised that there are only about 20, 000 genes!!

How is the information in DNA used by the cell? Make a protein to do a job!!! The genes present in the DNA of an organism determine the genotype. The expression, presence and action of proteins determine the phenotype of an organism Copyright © 2009 Pearson Education, Inc.

genotype phenotype

What will process of protein synthesis need to include? Are DNA and Proteins the same language? ? Where is the DNA? Where are proteins made? Can the DNA LEAVE the nucleus? How do the enzymes know where the gene starts?

What has to happen before the protein is made? FIRST: the gene needs to be COPIED so it can leave the nucleus! SECOND: The language needs to be changed- DNA & RNA are nucleic acid (A, C, G, T/U) & Proteins are _____. These are accomplished in 2 different steps.

The “flow” of genetic information in an organism is accomplished in 2 steps.

DNA Transcription RNA Nucleus Cytoplasm Translation Protein

Transcription Genetic information in DNA is copied to m. RNA. Where does it happen? What is m. RNA? Why is it necessary?

Answers: Nucleus messenger RNA Need to transport coding info from the nucleus to the ribosomes.

How is RNA different from DNA? RNA= ribonucleic acid; Ribose sugar; phosphate; nitrogen base Adenine, Guanine, Cytosine, and URACIL (base pairs= C-G; AU); Which base is missing/replaced? Single Stranded

Nitrogenous base (A, G, C, or U) Phosphate group Uracil (U) Sugar (ribose)

Transcription has three main phases: 1. Initiation 2. Elongation 3. Termination

1. Initiation – RNA polymerase (enzyme) binds to DNA at specific sequence called a Promoter (a signal to start transcription) and the DNA unwinds (strands separate)

2. Elongation – Only one strand of DNA is copied Complementary nucleotides are added along the sense strand Newly synthesized strand does NOT stay bound to template

3. Termination – When end of gene reached (a stop sequence), the RNA polymerase is released from DNA

Strand to be transcribed DNA Transcription RNA Start codon Stop codon

Transcription Animation http: //www. johnkyrk. com/DNAtranscription. html http: //www. stolaf. edu/people/giannini/flashanimat/ molgenetics/transcription. swf

http: //www. hhmi. org/biointeractive/dnatranscription-basic-detail

http: //www. hhmi. org/biointeractive/dna-replicationbasic-detail

Eukaryotic RNA is processed in 3 ways before leaving the nucleus After being transcribed, Eukaryotic m. RNA has to be processed before it can leave the nucleus 1. Cap added to 5’ end: single guanine nucleotide 2. Tail added to 3’ end: Poly-A tail of 50– 250 adenines Copyright © 2009 Pearson Education, Inc.

Eukaryotic RNA is processed in 3 ways before leaving the nucleus, cont. 3. The DNA encoding the gene AND the RNA copy have interrupting sequences called introns that separate the coding regions called exons. – RNA splicing: removal of introns and joining of exons to produce a continuous coding sequence

Exon Intron Exon DNA Cap RNA transcript with cap and tail Transcription Addition of cap and tail Introns removed Tail Exons spliced together m. RNA Coding sequence Nucleus Cytoplasm

m. RNA Splicing – Non-coding sequences (introns) are removed and coding (exons) are spliced together to make mature m. RNA (in EUKARYOTIC CELLS only!)

Transcribe! Write the DNA sequence of a gene (at least 36 nucleotides long. ) Include at least 1 intron! Transcribe the sequence of the gene into m. RNA

What happens next. TRANSLATION What do you do when you go from one language to another? You TRANSLATE! “Translation” involves switching from the nucleotide “language” of nucleic acids to amino acid “language” of proteins!

Translation, cont. Key “Players”: m. RNA t. RNA (transfer RNA) Ribsosomes Amino acids Where does it happen? The CYTOPLASM

m. RNA brings instructions (in the order of the bases!) for building the protein to the cytoplasm Translation takes place on the ribosomes (machine that makes the protein) t. RNA (transfer RNA) “reads” the m. RNA and supplies the CORRECT, corresponding amino acid (the TRANSLATOR!!)

In m. RNA, Codons serve as “words” of the genetic code A codon is made up of three nucleotide bases (A, U, G, C). Each codon specifies an amino acid (MONOMER) in the protein being made (POLYMER) The codon in m. RNA is “read” by the t. RNA

Take your m. RNA. Put a line after every codon (do NOT include the 5’ G cap) Translate your m. RNA using the Codon Table

DNA strand Transcription RNA Codon Translation Polypeptide Amino acid

Characteristics of the Genetic Code: 64 possible codons: – 61 correspond to the 20 amino acids – 3 “stop” codons signal the end of translation Redundant: More than one codon for many amino acids Unambiguous: Any codon for one amino acid does not code for any other amino acid Codons are adjacent to each other with no gaps in between ( no spacers or punctuation!) Nearly universal for ALL life!

Amino acid attachment site Hydrogen bond RNA polynucleotide chain Anticodon t. RNA

Transfer RNA molecules serve as interpreters during translation Transfer RNA (t. RNA) molecules match an amino acid to its corresponding m. RNA codon – t. RNA structure allows it to convert one language to the other: – – Each t. RNA carries a specific amino acid On other end of t. RNA is an anticodon that binds to a specific m. RNA codon, complementary in sequence (A pairs with U, G pairs with C) Copyright © 2009 Pearson Education, Inc.

Ribosomes build polypeptides Translation occurs on the surface of the ribosome – Ribosomes have two subunits, small and large, composed of ribosomal RNAs and proteins – Ribosomal subunits come together during translation – Ribosomes have binding sites for m. RNA and t. RNAs Copyright © 2009 Pearson Education, Inc.

t. RNA molecules Growing polypeptide Large subunit m. RNA Small subunit

Next amino acid to be added to polypeptide Growing polypeptide t. RNA m. RNA Codons

3 steps to translation: As in Transcription, there are 3 steps in the process of translation: 1. Initiation 2. Elongation 3. Termination

An initiation codon marks the start of an m. RNA message Initiation brings together the components needed to begin RNA synthesis (ribosome subunits, m. RNA, t. RNA) Translation will begin at the start codon, AUG, which codes for methionine. Copyright © 2009 Pearson Education, Inc.

Elongation adds amino acids to the polypeptide chain until a stop codon terminates translation Elongation is the addition of amino acids to the growing polypeptide chain Termination of translation occurs when the ribosome encounters a “stop” codon: The completed polypeptide is released The ribosomal subunits separate m. RNA is released and can be translated again Copyright © 2009 Pearson Education, Inc.

http: //www. hhmi. org/biointeractive/dna/DNAi_trans lation_vo 1. html

How do WE know which codon specifies which amino acid? Read the Codon table!! Example codon: AUG: A= position 1 U= position 2 G= position 3 Which amino acid? ? ?

Third base First base Second base

Transcribe and Translate Transcribe and translate the following DNA sequence: TAC GAT TAC ACA TTC ACT Are there any problems with the sequence? If C were change to A in the fifth codon what would happen? What do we CALL this change? ?

Translate m. RNA: AUGCAGUCAGGAGCUAUUCAUUAA Start at the first nucleotide on the left and mark to the right of every 3 nucleotides (1 codon!) Translate each of these codons using the codon table.

Overview of Protein Synthesis