Normalization Getting the numbers comparable DNA Microarray Bioinformatics
Normalization Getting the numbers comparable DNA Microarray Bioinformatics - #27612
The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Normalization Expression Index Calculation Comparable Gene Expression Data Statistical Analysis Fit to Model (time series) Advanced Data Analysis Clustering Meta analysis PCA Classification Survival analysis Promoter Analysis Regulatory Network DNA Microarray Bioinformatics - #27612
Expression intensities are not just target concentrations • • Sample contamination RNA quality Sample preparation Dye effect (cy 3/cy 5) Probe affinity Hybridization Unspecific signal (background) Saturation • Spotting • Other issues related to array manufacturing • Image segmentation • Array spatial effects DNA Microarray Bioinformatics - #27612
Two kinds of variation in the signal Global variation RNA quality Sample preparation Dye Hybridization Photodetection Systematic Gene-specific variation Spotting (size and shape) Cross-hybridization Dye Biological variation – Effect – Noise Stochastic DNA Microarray Bioinformatics - #27612
Sources of variation Global variation: Gene-specific variation: Systematic Stochastic • Similar effect on many measurements • Corrections can be estimated from data Normalization • Too random to be explicitly accounted for • “noise” Statistical testing DNA Microarray Bioinformatics - #27612
Calibration = Normalization = Scaling DNA Microarray Bioinformatics - #27612
Nonlinear normalization DNA Microarray Bioinformatics - #27612
Lowess Normalization * M * * * A One of the most commonly utilized normalization techniques is the LOcally Weighted Scatterplot Smoothing (LOWESS) algorithm. DNA Microarray Bioinformatics - #27612
The Qspline method From the empirical distribution, a number of quantiles are calculated for each of the channels to be normalized (one channel shown in red) and for the reference distribution (shown in black) A QQ-plot is made and a normalization curve is constructed by fitting a cubic spline function As reference one can use an artificial “median array” for a set of arrays or use a log-normal distribution, which is a good approximation. DNA Microarray Bioinformatics - #27612
Once again…qspline Accumulating quantiles When many microarrays are to be normalized to each other an average array can be used as target DNA Microarray Bioinformatics - #27612
Invariant set normalization (Li and Wong) A invariant set of probes is used -Probes that does not change intensity rank between arrays -A piecewise linear median line is calculated -This curve is used for normalization DNA Microarray Bioinformatics - #27612
Spatial normalization Raw data After intensity normalization Spatial bias estimate After spatial normalization DNA Microarray Bioinformatics - #27612
The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Normalization Expression Index Calculation Comparable Gene Expression Data Statistical Analysis Fit to Model (time series) Advanced Data Analysis Clustering Meta analysis PCA Classification Survival analysis Promoter Analysis Regulatory Network DNA Microarray Bioinformatics - #27612
Expression index value Some microarrays have multiple probes addressing the expression of the same target However for. Gene. Chips downstreamhave analysis we often want to deal – Affymetrix 11 -20 probe pairs pr. Gene with only one value pr. gene. - Perfect Match (PM) Therefore we want to collapse the -intensities from many Mis. Match (MM) probes into one value: PM: a gene CGATCAATTGCACTATGTCATTTCT expression index value MM: CGATCAATTGCAGTATGTCATTTCT DNA Microarray Bioinformatics - #27612
Expression index calculation Simplest method? Median But more sophisticated methods exists: d. Chip, RMA and MAS 5 DNA Microarray Bioinformatics - #27612
d. Chip (Li & Wong) Model: PMij = i j + eij Outlier removal: – Identify extreme residuals – Remove – Re-fit – Iterate Distribution of errors eij assumed independent of signal strength (Li and Wong, 2001) DNA Microarray Bioinformatics - #27612
RMA Robust Multi-array Average (RMA) expression measure (Irizarry et al. , Biostatistics, 2003) For each probe set, re-write PMij = i j as: log(PMij)= log( i ) + log( j) Fit this additive model by iteratively re-weighted leastsquares or median polish DNA Microarray Bioinformatics - #27612
MAS. 5 Micro. Array Suite version 5 uses Signal = Tukey. Biweight{log(PMj - MM*j)} MM* is an adjusted MM that is never bigger than PM Tukey biweight is a robust average procedure with weights and outlier rejection DNA Microarray Bioinformatics - #27612
Methods compared on expression variance Standard deviation of gene measures from 20 replicate arrays Std Dev of gene measures from 20 replicate arrays Expression level RMA: Blue and Red MAS 5: Green d. Chip: Black From Terry speed DNA Microarray Bioinformatics - #27612
Robustness MAS 5. 0 Log fold change estimate from 20 ug c. RNA MAS 5. 0 Log fold change estimate from 1. 25 ug c. RNA (Irizarry et al. , Biostatistics, 2003) DNA Microarray Bioinformatics - #27612
Robustness d. Chip Log fold change estimate from 20 ug c. RNA d. Chip Log fold change estimate from 1. 25 ug c. RNA (Irizarry et al. , Biostatistics, 2003) DNA Microarray Bioinformatics - #27612
Robustness RMA Log fold change estimate from 20 ug c. RNA RMA Log fold change estimate from 1. 25 ug c. RNA (Irizarry et al. , Biostatistics, 2003) DNA Microarray Bioinformatics - #27612
All of this is implemented in… R In the Bio. Conductor packages ‘affy’ (Gautier et al. , 2003). DNA Microarray Bioinformatics - #27612
References Li and Wong, (2001). Model-based analysis of oligonucleotide arrays: Model validation, design issues and standard error application. Genome Biology 2: 1– 11. Irizarry, Bolstad, Collin, Cope, Hobbs and Speed, (2003) Summaries of Affymetrix Gene. Chip probe level data. Nucleic Acids Research 31(4): e 15. ) Affymetrix Microarray Suite User Guide. Affymetrix, Santa Clara, CA, version 5 edition, 2001. Gautier, Cope, Bolstad, and Irizarry, (2003). affy - an r package for the analysis of affymetrix genechip data at the probe level. Bioinformatics DNA Microarray Bioinformatics - #27612
- Slides: 24