New Diseases or Reemerging Threats Current Knowledge state

New Diseases or Re-emerging Threats Current Knowledge state- Avian Reoviruses and Clubbed Down Syndrome SWCA 8 th April 2014 Philip P Hammond BVet. Med PGCert Avian Health (hons) MAHM MRCVS Crowshall Veterinary Services

Topics Covered: 1) Reovirus tenosynovitis 2) Clubbed Down Syndrome • • • Presentation Investigations Epidemiology Treatment and Prevention Future Research

Clinical History • • Integrated company Initially one house on one farm affected May 2013 Ross 308 broilers Age 14 days of age at onset of symptoms

Presentation: • • Birds reported lame “walking on their hocks using wings to balance”- acute onset at 13 -14 days of age. Approximately 5% affected (1200 birds) Poor uniformity Poor growth rates Courtesy of AAAP

First Step: Post mortem examination: • • • Birds demonstrated mild bilateral tenosynovitis of gastrocnemius tendon- increased fluid in hocks Concurrent mild pericarditis/epicarditis No other gross pathology Courtesy of AAAP

Differential Diagnoses: Primarily considered likely infectious agent given inflammation and effusion of tendon • • Mycoplasma synoviae Staphylococcus tenosynovitis arthritis Enterococcus tenosynovitis/arthritis Reovirus tenosynovitis/arthritis

Course of investigation: Step 1 - Staphylococcus tenosynovitis/ arthritis • Swabs taken from hocks, tendons and pericardial tissues • Results – no growth after 48 hours • Birds swabbed not being treated with antibiotics and investigation undertaken at early stage of infection • NOT STAPHYLOCOCCUS OR ENTEROCOCCUS TENOSYNOVITIS/ARTHRITIS

Step 2 Mycoplasma synoviae Serology: Rapid serum agglutination on sera of 20 birds showing symptoms in affected flock- taken at time of site visit Results- negative However- serology relies on antibody production- acute vs convalescent phase of infection- could not rule out on the basis of this test alone

Mycoplasma synoviae PCR • • PCR (Birds NOT on antibiotics) • CULTURE- Chanocks- NEGATIVE • NOT MS INFECTION

ALSO……. Mycoplasma synoviae infection is both vertically and horizontally transmitted All PS in integrated company MS negative as monitored serologically throughout lay- some flocks also Poultry Health Scheme status

Histology: Tendons, joint capsule and tendon sheath- mixed inflammatory infiltrate- both heterophilic and lymphoplasmacytic NOT POSSIBLE TO DETERMINE WHETHER BACTERIAL OR VIRAL FROM HISTOLOGY ALONE

Then……. . Over course of following 2 months- multiple cases on multiple farms all within same integration Issues also being reported all over UK and throughout Europe 8 -12% mortality due to culling No response to antibiotic treatment either antimycoplasmal or amoxycillin Welfare concerns due to lameness Poor conversion 1. 80+ vs 1. 62 Poor uniformity Some response to aspirin treatment- • better mobility, lower culling rates

Data analysis: • • • Common link for the above case- 80% of cases affected progeny from a specific flock- breeder flock between 28 -40 weeks- 35000 birds in 6 houses Not all progeny from specific flock were affected Other flocks placed at the same time from the same hatch day were occasionally affected Chicks were hatched in two different hatcheries- problem occurred in chicks from both Broiler farm location did not appear to be related to incidence

Step 3 - Virus isolation • • • Aseptically extracted tendon tissue from first case Virus isolation conducted by AHVLA Weybridge 3 Passages • Reovirus isolated FROM TENODON TISSUE

Gene Sequencing Undertaken “ACTGAGCATACTGCAAATAATAGCACAATGATGGATTTTTGCGTGCTTGGATTCC TCTGGCGCGTCTGATGTGCTGAAGAAGTTTTGCAAATCCATTTCGATACAACGGAATTATGTTT GTCAGGGTGACGATGGTTTGATGGTTGTTGACGGGCTGTCGACGGGTAAGTTATCAGGTGAG ATAATT” 86% similarity with the virus T 17811. “Arch Virol. 2013 Jun 16. Detection and characterization of a divergent avian reovirus strain from a broiler chicken with central nervous system disease. ” Dandár E, Bálint A, Kecskeméti S, Szentpáli-Gavallér K, Kisfali P, Melegh B, Farkas SL, Bányai K. NOT A NEW VIRUS ? ? ?

Development of SNT to virus by AHVLA Weybridge: • Some evidence of seroconversion in broilers- not consistent • Evidence of seroconversion in one parent flock from where majority of affected progeny derived • Low rate of seroconversion

• Cases of Reovirus tenosynovitis have been reported through the UK in a number of integrations this year • Cases of Reovirus tenosynovitis have been reported throughout Europe throughout the last year

Unanswered Questions! • • • Why have so many companies and countries suddenly reported this syndrome? Why have some flocks which have not been derived from the known positive PS also developed symptoms? - cross infection in hatchery? Why did some flocks from the same parent flock not show symptoms? - age related resistance? Is this a new strain of Reovirus or is it a previously recognised strain? - Reoviruses appear to be continuously involving What methods are being used to type Reovirus and are these consistent throughout laboratories? - there is no consistency at this time Will double Nobilis Reo inac vaccination confer protection?

What can we do to prevent? • Biosecurity- hatching egg hygiene • Hatchery hygiene • Vaccination- double vaccination strategy advised in UK • Sigma B antibodies • Autogenous vaccination

Affect of 2 x Nobilis Reo inac adminsitered at 14 and 18 weeks of age on ELISA antibody titres at 22 weeks of age in Broiler PS (Biochek) Mean Reovirus Titres 22 weeks of age 30000 24212 Mean Titre 25000 20399 20000 14059 15000 10000 5471 13991 8530 6584 10101 5000 0 Series 1 Farm 1 5471 Farm 2 6584 Farm 3 14059 Farm 4 8530 Farm 5 10101 Farm Name Farm 6 13991 Farm 7 20399 Farm 8 24212

Clubbed Down Syndrome The symptoms and definition:

Definition: • Chicks with clubbed down will have matted down, in which the down feathers remain held together and look like clubs. (banana down)- may also be hairy • The defective down is most commonly seen on the ventral aspect of the chick especially around the vent. • Reduced hatchability, due to weak chicks and increased late dead, with most demonstrating clubbed down. • Chicks in a normal hatch (<0. 5%) may show some down abnormalities, including clubbed down. • With clubbed down syndrome the incidence of chicks with clubbed down is greater than 2%, usually with a similar loss of hatch. It is only clubbed down if the condition is seen in all hatches over a period of time (weeks to months) from a specific source flock.

Observations: • Breeders no clinical signs, production levels are normal and egg quality both internal and external looks the same • Chicks have to be culled in hatcher baskets, usually 3 -30%, but often many weak chicks resulting in further losses at around 4 -6 days of age on broiler farm • Sometimes parent flocks improve rapidly whilst others take many weeks to show any improvement, others may never fully recover • Spread between breeder houses on a farm can be very slow leading to a protracted disease progression

Possible Causes of Clubbed Down: Riboflavin deficiency – histology has ruled out in recent cases Zinc deficiency – blood analysis on chicks indicates low levels in affected chicks • Feed analysis of breeder rations shows no deficiency so a more complex situation Viruses • • Entero like viruses Circovirus, Adenovirus Astroviruses

AFBI Stormont Work and recent corroboration Previously Virus Isolation • • An “entero-like virus” (11672) has previously been isolated from chicks with clubbed down In SPF eggs, killed embryos and cause stunting. But no CD seen with embryo inoculation. Not all Clubbed Down flocks positive for this virus This virus has now been identified as an Avian Astrovirus

• Recent cases where we have been able to demonstrate seroconversion to Chicken Astrovirus using acute and convalescent sera from the parent stock

Update on Clubbed Down Research: 1) Causal agent has not been identified • Previously Fowl adenovirus 8 was thought to be involved but now ruled out 2) Can Chicken Astrovirus be ruled out as the cause? • Research has shown that if Chicken Astovirus is the causal agent, it does not cause clubbed down by replicating in the embryo • Therefore, may be infecting the breeder hen and affecting the formation of normal eggs- it may be acting physiologically to reduce transfer of nutrients in to the egg hence why progeny show symptoms of typical nutrient deficiency

Further investigation are required to understand more about this syndrome: By infecting a known negative flock with Chicken Astrovirus it may be possible to ascertain if: • Clubbed down can be reproduced • Where the virus replicates in the bird • How the virus affects hatchability (direct or indirect) • If vertical transmission is occurring at all?

Diagnosis Molecular diagnostics to quantify the levels of Astovirus present • Kidney, gut, ovaries, oviduct Serology- monitoring of breeder flocks- will commercial assays be available one day? • indirect immunofluorescence assay • ELISA One major diagnostic challenge is that by the time the issue is observed in the progeny the virus may have already gone 4 weeks later. How to overcome- routine storage of tissues and sera from PS? ? ? Practicalities? Control Ultimate aim to vaccinate breeders to prevent infection. Astroviruses may be common place on broiler farms with limited clinical effects but the effects on breeders in lay may be the major issue as seen with Chick Anamia virus and Avian Encephalomyelitis. We may need to have a test to see if flocks have seroconverted in rear and then vaccinate if they have failed to do so

With thanks to the following in respect of Investigations: Kathy Blake -Crowshall Veterinary Services LLP Stephen Lister -Crowshall Veterinary Services LLP Claire Knott -Crowshall Veterinary Services LLP Ian Lowery -Crowshall Veterinary Services LLP Vanessa Ceeraz, AHVLA Weybridge Scott Reid, AHLVA Weybridge Richard Irvine, AHLVA Luddington Bill Cox, AHVLA Weybridge Tibor Cserep, MSD Animal Health UK Victoria Smyth AFBI Northern Ireland

We do not have all the answers but by working together we can help to understand focus the limited research resources we have to gain the most knowledge. Microbiological agents are always evolving and at a much faster rate than either us or the chicken! Thank you for listening phammond@crowshall. co. uk www. crowshall. co. uk