Molecularly Distinct ClathrinCoated Pits Differentially Impact EGFR Fate

  • Slides: 9
Download presentation
Molecularly Distinct Clathrin-Coated Pits Differentially Impact EGFR Fate and Signaling Roberta Pascolutti, Veronica Algisi,

Molecularly Distinct Clathrin-Coated Pits Differentially Impact EGFR Fate and Signaling Roberta Pascolutti, Veronica Algisi, Alexia Conte, Andrea Raimondi, Mithun Pasham, Srigokul Upadhyayula, Raphael Gaudin, Tanja Maritzen, Elisa Barbieri, Giusi Caldieri, Chiara Tordonato, Stefano Confalonieri, Stefano Freddi, Maria Grazia Malabarba, Elena Maspero, Simona Polo, Carlo Tacchetti, Volker Haucke, Tom Kirchhausen, Pier Paolo Di Fiore, Sara Sigismund Cell Reports Volume 27 Issue 10 Pages 3049 -3061. e 6 (June 2019) DOI: 10. 1016/j. celrep. 2019. 05. 017 Copyright © 2019 The Author(s) Terms and Conditions

Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019. 05. 017)

Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019. 05. 017) Copyright © 2019 The Author(s) Terms and Conditions

Figure 1 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019.

Figure 1 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019. 05. 017) Copyright © 2019 The Author(s) Terms and Conditions

Figure 2 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019.

Figure 2 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019. 05. 017) Copyright © 2019 The Author(s) Terms and Conditions

Figure 3 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019.

Figure 3 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019. 05. 017) Copyright © 2019 The Author(s) Terms and Conditions

Figure 4 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019.

Figure 4 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019. 05. 017) Copyright © 2019 The Author(s) Terms and Conditions

Figure 5 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019.

Figure 5 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019. 05. 017) Copyright © 2019 The Author(s) Terms and Conditions

Figure 6 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019.

Figure 6 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019. 05. 017) Copyright © 2019 The Author(s) Terms and Conditions

Figure 7 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019.

Figure 7 Cell Reports 2019 273049 -3061. e 6 DOI: (10. 1016/j. celrep. 2019. 05. 017) Copyright © 2019 The Author(s) Terms and Conditions

IPASS EGFR wildtype EGFR mutationpositive Gefitinib n132 CarboplatinpaclitaxelIPASS EGFR wildtype EGFR mutationpositive Gefitinib n132 Carboplatinpaclitaxel
EGFR AP 2 EGFR agtgctgggaacgcccctctcggaaattaactcctcagggcacccgctcccatgcgccgccccactcc cgccggagactaggtcccgcgggggccaccgctgtccaccgcctccgg CGgccgctggccttgggtccccgct gctggttctcctcctcgcattctcctctgctcctcccgatccctcctccgccgcctggtcEGFR AP 2 EGFR agtgctgggaacgcccctctcggaaattaactcctcagggcacccgctcccatgcgccgccccactcc…
The Fate of the Universe The fate dependsThe Fate of the Universe The fate depends
The fate of supermassive stars The fate ofThe fate of supermassive stars The fate of
FATE CHANCE Usually discussions about fate and chanceFATE CHANCE Usually discussions about fate and chance
Postgre SQL Postgre SQL DISTINCT Postgre SQL DISTINCTPostgre SQL Postgre SQL DISTINCT Postgre SQL DISTINCT
IMPACT Guide for Pits Equipment Prepared for theIMPACT Guide for Pits Equipment Prepared for the
EGFR Mutation Impact on Definitive Concurrent Chemoradiation TherapyEGFR Mutation Impact on Definitive Concurrent Chemoradiation Therapy